1 / 54

RECOMBINANT DNA TECHNIQUES and PROTEIN ENGINEERING

RECOMBINANT DNA TECHNIQUES and PROTEIN ENGINEERING. Polymerase chain reaction. Polymerase chain reaction. Kary B. Mullis, Cetus, 1985, 1993 http://www.nobel.se/chemistry/laureates/1993/mullis-lecture.html

bruno-mclean
Download Presentation

RECOMBINANT DNA TECHNIQUES and PROTEIN ENGINEERING

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. RECOMBINANT DNA TECHNIQUESandPROTEIN ENGINEERING Polymerase chain reaction

  2. Polymerase chain reaction • Kary B. Mullis, Cetus, 1985, 1993 • http://www.nobel.se/chemistry/laureates/1993/mullis-lecture.html • In 1989 Science named the molecule used in PCR, Taq Polymerase, its first "Molecule of the Year". • In 1992 Cetus, who own the intellectual property rights for the technique (granted in 1989), underwent a corporate reorganisation and sold the patent for PCR and Taq polymerase to Hoffmann-La Roche for $300 million (The USA patent for PCR is a national right and therefore requires that all American universities who wish to use PCR must obtain a licence. Universities and research environments in Europe are exempt from this patent and are allowed to use the technique without a licence). • http://www.pcrlinks.com/

  3. PCR Template, primer, amplikon

  4. PCR Template, primer, amplikon

  5. PCR Template, primer, amplikon

  6. PCR Template, primer, amplikon

  7. PCR Template, primer, amplikon

  8. PCR Template, primer, amplikon

  9. PCR Template, primer, amplikon

  10. one to several minutes at 94-96 oC, during which the DNA is denatured into single strands; • one to several minutes at 50-65 oC, during which the primers hybridize or "anneal" to their complementary sequences on either side of the target sequence; and • one to several minutes at 72 oC, during which the polymerase binds and extends a complementary DNA strand from each primer.

  11. Two important innovations were responsible for automating PCR. • A heat-stable DNA polymerase was isolated from the bacterium Thermus aquaticus, which inhabits hot springs (Taq polymerase). • DNA thermal cyclers were invented that use a computer to control the repetitive temperature changes required for PCR.

  12. The theoretical amplification value is never achieved in practice. Several factors prevent this from occurring, including: Competition of complementary daughter strands with primers for reannealing (i.e. two daughter strands reannealing results in no amplification). Loss of enzyme activity due to thermal denaturation, especially in the later cycles Even without thermal denaturation, the amount of enzyme becomes limiting due to molar target excess in later cycles (i.e. after 25 - 30 cycles too many primers need extending) Possible second site primer annealing and non-productive priming

  13. For a given number of cycles 'n' we make 2n*T0total possible duplexes For a given number of cycles there will be 2(n+1)*T0 duplexes which are formed from either the original template, or a fragment of indeterminate length, along with a fragment of defined length (and represent an undesired product) Thus, the total concentration of desired product (duplexes with a length defined by the PCR primers) will be(2n - 2(n+1))*T0 (where T0 is the concentration of the original duplex)

  14. Asymmertic Degenerate Hot-start In-situ Inverse LA- Multiplex Nested RACE Real-time RT- Touchdown one oligo in high excess base on a.a. sequence to increase specificity in tissue sections what is outside? long and accurate several oligo pairs 2 oligo pairs rapid amplification of cDNA ends continuous detection of products coupled to reverse transcription continuous decrease of annaeling temperature Different forms of PCR

  15. Reaction Buffer Recommended buffers generally contain : 10-50mM Tris-HCl pH 8.3, up to 50mM KCl, 1.5mM or higher MgCl2, 0.2 - 1uM each primer, 50 - 200uM each dNTP, gelatin or BSA to 100ug/ml, and/or non-ionic detergents such as Tween-20 or Nonidet P-40or Triton X-100 (0.05 - 0.10% v/v) additive reagents for special applications: DMSO betaine formamide

  16. Primer design A simple set of rules for primer sequence design 1. primers should be 17-28 bases in length; 2. base composition should be 50-60% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents"breathing" of ends and increases efficiency of priming; 4. Tms between 55-80oC are preferred; 5. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 6. 3'-ends of primers should not be complementary (ie. base pair), as otherwise primer dimers will be synthesized preferentially to any other product; 7. primer self-complementarity (ability to form 2o structures such as hairpins) should be avoided.

  17. KOD polymerase

  18. Phusion polymerase

  19. Single sperm PCR Amelogenin PCR product from 5 ng genomic DNA of bull (B) and cow (C).

  20. Multiplex PCR Fig. 42. Comparative multiplex PCR using mixtures A to D with 5% DMSO (superscript D) and without DMSO, in 1x buffer. Some loci from mixture A (blue arrows) are stronger when no DMSO is used. However, DMSO helps amplify (magenta arrows) one locus in mix B and one locus in mixture D. Amplification of PCR products of mixture C* were unaffected by DMSO.

  21. PCR Hot Start Techniques Using Wax Beads Human genomic DNA was used as a template for the PCR amplification of a region of the human glucocerebrosidase gene. A RoboCycler Gradient 40 temperature cycler fitted with a Hot Top Assembly was used to amplify reactions in 600-ml thin-wall tubes. Each 50-ml PCR reaction contained 250 mM of each dNTP, 50 ng of human genomic DNA, 100 ng of each primer1 and 5 U of Taq DNA polymerase in 1X Taq DNA polymerase buffer. Magnesium-free Taq DNA polymerase buffer was used in reactions containing StrataSphere magnesium wax beads. The cycling parameters were as follows: an initial 4-minute denaturation at 95°C; 30 cycles of 95°C for 1 minute, 60°C for 2 minutes and 72oC for 1 minute followed by a final, 10-minute incubation at 72°C. After cycling, 10-ml aliquots from each tube were electrophoresed through a 6% polyacrylamide/TBE gel, stained with ethidium bromide and visualized using the Eagle Eye II still video system. Lanes 1 and 2: Reactions without a hot start method. Lanes 3 and 4: Reactions with StrataSphere magnesium wax beads and magnesium-free buffer. Lanes 5 and 6: Hot start reactions using standard magnesium-free wax beads to separate Taq DNA polymerase and the DNA template from the remaining reaction components. Lane M: Lambda/Hind III-fC174/Hae III molecular weight marker.

  22. Hot start PCR – inactivated enzyme

  23. Hot start PCR – IgG komplex M = DNA Marker;Lanes 1-4. Standard PCR on 4 ng template DNA;Lanes 5-8. Hot Start PCR using JumpStart REDTaqon 4 ng template DNA M = DNA Marker;Lanes 1-4. Standard PCR on 0.4 ng template DNA;Lanes 5-8. Hot Start PCR using JumpStart REDTaqon 0.4 ng template DNA.

  24. HotMaster Taq • Superior product features for “hot start” PCR applications • HotMaster™ Taq Polymerase does not require heat activation • Continuous annealing temperature control throughout the PCR • Extended target size range for PCR amplification (up to 5 kb) • Pre-optimized universal magnesium concentration in the buffer • No protein contamination of the PCR by denatured antibodies

  25. Inverse PCR • Genetics. 1995 139(2):757-66. • An inverse PCR screen for the detection of P element insertions in cloned genomic intervals in Drosophila melanogaster.Dalby B, Pereira AJ, Goldstein LS

  26. PCR cloning 5’ P!!!

  27. Study of polymorphism • SNP: • allele specific PCR (Taq) • SSCP-PCR

  28. Study of polymorphism • Larger insertion, deletion • repetitive sequences

  29. RT-PCR • RNA isolation • Total • mRNA • One reaction(Tth polymerase) vs. 2 reactions RTase+polymerase • Primer for reverse transcription: • Oligo dT • Random hexamer • gene specific • Primers for PCR • gene specific

  30. Total RNA isolation • friss szövet – folyékony N2 – TRI reagent

  31. Total RNA isolation

  32. Total RNA isolation • Preparation/ storage of cells or tissue: RNAlater

  33. RT-PCR • RNA izolation • Total • mRNA • One reaction(Tth polymerase) vs. 2 reactions RTase+polymerase • Primer for reverse transcription: • Oligo dT • Random hexamer • gene specific • PCR • gene specific

  34. RACE: rapid amplification of cDNA ends • 3’ RACE:oligo dT (anchored) + gene specific oligo • 5’ RACE: • single strand ligation to the 5’end of mRNA • tailing with TdT

  35. RACE: rapid amplification of cDNA ends • 3’ RACE:oligo dT (anchored) + gene specific oligo • 5’ RACE: • single strand ligation to the 5’end of mRNA

  36. Real time PCR Tn = (1+Y)nT0 Y<1

  37. Intercalating Dyes The most simple detection method in real time PCR requires a dye that emits fluorescent light when intercalated into double-stranded DNA. The intensity of the fluorescence signal is proportional to the amount of all double-stranded DNA present in the reaction. The first experiments were performed with ethidium bromide and YO-PRO-1 as intercalating dyes. Actually, SYBR Green I is the most frequently used. Because these dyes don't make a distinction between the different dsDNA molecules in a PCR reaction, the formation of non-specific amplicons must be prevented. Therefore, accurate primer design and optimisation of the reaction conditions for the primers are required. After the PCR reaction, an additional time-temperature program provides a melting curve to detect the presence of high amounts of non-specific sequences. These non-specific sequences show melting peaks different to the template sequences. Thanks to this control option, intercalating dyes are reliable. Nevertheless, when considering these precautions, this technique provides a simple and effective method to monitor PCR's.

  38. Hydrolysis Probes The hydrolysis or Taqman probe chemistry depends on the 5'-3' nuclease activity of Thermus aquaticus DNA-polymerase. A DNA probe, labelled with a reporter dye and a quencher dye at opposite ends of the sequence, is designed to hybridise within the amplicon. FAM (6-carboxyfluorescein) and TAMRA (6-carboxy-tetramethyl-rhodamin) are most frequently used as reporter and as quencher respectively. In an intact probe, the fluorescence of the reporter is suppressed by the quencher. Once the probe hybridises to the template, the polymerase cleaves the probe and the fluorescence of the reporter increases in proportion to the quantity of amplicons present.

  39. Hybridisation Probes This detection method relies on the fluorescence resonance energy transfer (FRET) principle and makes use of two oligonucleotide probes. One probe is labelled with a donor fluorochrome (fluorescein)at the 3' end and the other probe is labelled with an acceptor dye (Cy5, LC Red 640) at the 5' end. The probes can hybridise to the target sequences so that they are one base distant and head-to-tail oriented. In that position, the energy emitted by the donor dyes excites the acceptor dye of the second probe, which then emits fluorescent light at a longer wavelength. The ratio between donor fluorescence and acceptor fluorescence increases during the PCR and is proportional to the amount of target DNA generated.

  40. Molecular Beacons Molecular Beacons are stem-and-loop shaped hybridisation probes with a fluorescent dye on one end and a quencher dye on the opposite end. The loop fragment of the probe is complementary to a sequence of the template and the two ends are complementary to each other so forming a hairpin like structure. When the probe is not hybridised, the fluorophore and the quencher are in close proximity resulting in a suppression of fluorescence. Once the conditions are optimal for hybridisation, the probe stretches out and the quenching effect drops resulting in detectable fluorescence. Because the hairpin shape is very thermostable, molecular beacons have a high specificity to hybridise to a target, which enables the detection of single nucleotide differences. This isn't possible with the Taqman chemistry. Therefore, molecular beacons are suitable for mutation analysis and single nucleotide polymorphism detection.

  41. Molecular beacons http://molecular-beacons.org/ fluorescein-5'GCGAGCTAGGAAACACCAAAGATGATATTTGCTCGC -3'-dabcyl, Operation of molecular beacons. On their own, these molecules are non-fluorescent, because the stem hybrid keeps the fluorophore close to the quencher. When the probe sequence in the loop hybridizes to its target, forming a rigid double helix, a conformational reorganization occurs that separates the quencher from the fluorophore, restoring fluorescence.

  42. Real-time measurements of amplicon concentrations during polymerase chain reactions containing molecular beacons in sealed tubes. Six polymerase chain reactions, each initiated with a different number of template molecules (as indicated in the figure), were performed in a fluorometric thermal cycler. Fluorescence was measured during the annealing stage of each temperature cycle. The amount of fluorescence in each cycle is proportional to the amplicon concentration

More Related