1 / 36

Primary repertoire - diversity in generating VDJ of mature naïve cells

Imin 401 - Lecture 9 - primary & secondary Ab repertoires. Primary repertoire - diversity in generating VDJ of mature naïve cells Secondary repertoire - modification of the primary repertoire by affinity maturation, mediated by AID mutator enzyme

clayton-bryan
Download Presentation

Primary repertoire - diversity in generating VDJ of mature naïve cells

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Imin 401 - Lecture 9 - primary & secondary Ab repertoires Primary repertoire - diversity in generating VDJ of mature naïve cells Secondary repertoire - modification of the primary repertoire by affinity maturation, mediated by AID mutator enzyme T-cells always generate their repertoire in the thymus B-cell repertoires develop in distinct locations, and by distinct means, depending on the species of vertebrate.

  2. control or loss of control of the immunoglobulin mutator AID Activation Induced Cytidine Deaminase (AID or AICDA) Controlled - AID mediates Ab affinity maturation & class switch Uncontrolled - AID can exacerbate autoimmunity or cause cancers AID

  3. A Uracil (once generated) will not H-bond to the guanine across from it deamination

  4. somatic hypermutations 'repair' of Uracils in DNA leads to point mutations &/or breaks in strands of DNA (breaks can happen on both DNA strands leading to Double Strand Breaks - DSBs) UNG – uracil-N-glycosylase APE – apurinic/apyrimidinic endonuclease leads to DSBs & class switching Nature Reviews Immunology5, 171-178 (2005)

  5. Somatic hypermutations & affinity maturation shapes the 2° repertoire of antibodies in the host (or at least mice & humans) cumulative mutations in 1000's of GC centrocytes Petersen-Mahrt, Svend DNA deamination in immunity. Immunological Reviews203 (1), 80-97.

  6. AID targets ssDNA in a transcription bubble 'repair' of uracil can leave breaks in the DNA or lead to point mutations Nature Immunology4, 429 - 430 (2003)

  7. Review - immunoglobulin repertoire development Repertoire - all forms of Ig (epitope recognition) present at given time - also true for TcR primary (1º) repertoire - prior to exposure to antigen/pathogen** secondary (2º) repertoire - after pathogen exposure & affinity maturation **exception to be covered today

  8. Mouse/ Human paradigm of Ig repertoire development Primary Repertoire Development - in Bone Marrow 1 Ig repertoire is by VDJ recombination - it is not antigen (pathogen) driven B-cell activation (by Ag) precedes Secondary Repertoire Development Activated B- & TH-cells can be attracted to a lymphoid follicle by chemokines secreted by follicular dendritic cells

  9. Ab affinity maturation part I (FDC) if no TH help  apoptosis via AID Kuby 11-20 (activated)

  10. Ab affinity maturation part II • affinity Ab class switched Proliferation, & then differentiation into memory or plasma cell Only centrocytes with hi affinity Ab bind Ag & get rescued from apoptosis Kuby 11-20

  11. Mouse/Human paradigm for B-cell development • In fetus - B-cells originate & become mature in BM (marrow) & Liver • After Birth - B-cells originate & become mature in BM • - new B-cells are generated throughout life • Primary B-cell encounter with Ag is mainly in PALS of Spleen (or LN) • 2 Ag exposure in Spleen, LN’s and MALT - 2 lymphoid organs • Lymphopoietic sites - Where lymphocytes differentiate & mature • for B-cells this is mostly BM in mouse & human • Hematopoietic sites - where all blood cells differentiate & mature

  12. Variations on Ig repertoire development - overview 1) 1 repertoire development and B-cell maturation occurs outside BM 2) 1 repertoire development mostly by SH &/or Gene Conversion 3) 1 repertoire development is Ag driven 4) affinity maturation outside of conventional germinal centres

  13. Increasing 1 repertoire diversity by somatic hypermutation Sheep, rabbits & swine have a modified translocon Ig genes - They use only a limited number of V-elements during VDJ recomb. therefore there's limited combinatorial diversity V1 - Vn V D’s J’s C IgH IgL V1 - Vn V J’s C

  14. Sheep & some other ruminants use AID for 1 repertoire development • fetal pre-B-cells move to & mature in Ileal Peyers Patches (IPP) • these are distinct Peyer's patches at the end of the small intestine • (cells are already VDJ recombined) • The 1 repertoire is generated partially by Somatic Hypermutation • B-cell proliferation follows SH (repertoire development) • Occurs only during 2nd half of fetal life & several months after birth • - after that the cells are thought to self-renew • Selection for B-cells is not antigen driven (except against self Ag recognition) Reynaud CA, Garcia C, Hein WR, Weill JC Cell. 1995 80(1):115-25

  15. How can you tell the repertoire develops from hypermutation? Compare genomic & expressed V-element sequences for differences e.g. Genomic ('allelic' differences in red) Vl1- ATGCAATTAGTACTA Vl2- ATTCAATTAGTACTA Vl3- ATGGAATTATTACTA Vl4- ATTCAATTATTACTA Expressed Vl?- ATTCAGTTAGTAGTA (underlined bases tell us it's a V2) Two base changes in this V2 expressed sequence (blue) are not seen in genomic - therefore presumed to be due to AID mutational process

  16. Increasing 1 repertoire diversity by gene conversion Birds have a different type of modified translocon Ig genes - only 1 or 2 functional V-elements available for recombination the rest are pseudogenes - that are used for gene conversion (pseudogenes) V1 - Vn V D’s J’s C IgH IgL V1 - Vn V J’s C

  17. Repertoire development by Gene Conversion Gene Conversion is a non-reciprocal transfer of gene sequence Net effect - for two segments of DNA with homologous sequence: one sequence of one the segments (donor) is imprinted onto the other segment (recipient). There is no change to the donor sequence. This is a non-reciprocal exchange of genetic information In the 'classical' immune system form - the donor sequence is a pseudogene Gene Conversion requires transcription & AID, for it to occur - like SH & CSR

  18. In Ig gene conversion donor V-elements are complexed proximal to the VDJ exon. AID mediated strand breaks in the VDJ exon allow it to invade a donor V-element. Polymerase uses the donor as template to extend the broken strand Repair of mismatches leads to fixation of ‘new’ nucleotides in the VDJ exon Azuaje et al.Kinetoplastid Biology and Disease 2007 6:6

  19. Limited V-element usage - modified Translocon organization Pseudogenes are the donor sequence for gene conversion (pseudogenes!?) V1 - Vn V D’s J’s C IgH IgL Donor segments for gene conversion - always from same gene (in cis) V1 - Vn V J’s C it's nearly impossible to study rare meiotic events like gene conversion unless you discover another system in which to study it - like birds

  20. Features to look for in gene conversion events: tracts > 9 bp long that are foreign to recipient & found in donor 3 nt long insertions or deletions (that are found in donor) [indels of 1 or 2 bp would cause frameshifts & stop codons] donor segment: ATGCATTTTTCCCGGGGCCCCTGCAT TACGTAAAAAGGGCCCCGGGGACGTA recipient seg: ATGCATTAATGGCCACCGTGCAT TACGTAATTACCGGTGGCACGTA Heteroduplex: ATGCATTTTTCCCGGGGCCCCTGCAT mismatches TACGTAAT TA CCG G TGGCACGTA

  21. Chickens (& the DT40 cell line) pre-B-cells are made in Bone Marrow - for only 10 days only 1 functional VH or VL exists and is used - the rest are pseudogenes () pre-B-cells go to Bursa (GALT tissue) 1 repertoire is generated by bona fide Gene Conversion (for a few weeks) pseudogenes (VL or fused VHD’s) serve as templates is repertoire generated in response to gut Ag? Possibly!

  22. Rabbits (and cattle & swine) • In marrow - VHDJH rearrangements biased to VH1-element • In rabbits B-cells mature in Appendix & other GALT (IPP in cattle & swine) • maturation is further diversification by SH & Gene Conversion-like process • Maturation is Ag driven by intestinal microflora • 1 repertoire development stops after 3 - 8 wks - cells self-renew? • 2 repertoire develops in spleen & LN - again by SH - & Gene Conversion? • There is evidence for rare gene conversion events in humans as well

  23. In most vertebrates the 12/23 rule & how RSSs are positioned ensure that there isn’t ‘inappropriate’ recombination events Kuby Fig. 5-6 Recombination Signal Sequences - RSS

  24. Shark RSSs are organized differently so that multiple types of recombination can occur! This compensates for the limited # of elements available for recombination Multi-cluster Ig gene organization - IgNAR form - has no light chain Only 5 NAR loci total - so very limited diversity!? RSS "a" RSS "b" V D’s J C NAR 1 repertoire has 1 to 4 recombinationsVJ- to VDDDJ-CNAR Each recombination has associated P & N-nucleotide additions

  25. Evolution of 12 & 23 bp RSSs The most parsimonious scenario would have one type of RSS donated by the invading transposons inverted repeat The RAG transposase operates as a homodimeric complex and doesn’t follow the 12/23 rule A second RSS type evolves along with a second RAG gene that recognizes it – this evolves into the 12/23 process Sharks have the 12/23 rule but recombines any element to any other element – within its locus When does the 12/23 rule become really important??

  26. Shark & Fish & Amphibian IgM (and IgY in frog) • 1 repertoire development - conventional - though no marrow in fish & shark • 2 repertoire development in spleen - very limited Affinity Maturation (< 10 fold ) • No germinal centers, therefore no selection for high affinity B-cells!? • Lymphotoxin (LT or LT) knockout mice - no lymph nodes or GCs in their spleen • These animals have similar affinity maturation intensity & kinetics as fishes

  27. Most text books identify GCs as only being in birds & mammals GALT Thymus Spleen Bone marrow lymph nodes Germinal Centres but how humans develop auto-antibodies shows some similarities to what happens in fish! The key may be that patients have unusual GCs!.

  28. Ectopic (aberrant) GCs can propagate auto-immunity tertiary lymphoid organ is another name for aberrant germinal centre

  29. Normal mammalian germinal centres are obvious in spleen even by standard histological techniques

  30. c ectopic or disease GCs are greatly varied in form … and in the extent to which affinity maturation occurs Does pathology recapitulate phylogeny? are disease GCs reverting to a primitive organization??

  31. fish spleen, like mammals, has areas of RBCs (pink) & leukocytes (blue), but no obvious GC-like structures Oko & Magor, unpublished

  32. v Red Pulp LR v v in situ hybridization shows that fish have small GC-like cell clusters AID anti-sense LR - leukocyte rich region AID negative - red arrow AID sense probe (Saunders et. al. Dev. Comp. Imm. 2010)

  33. in situ's show that hypermutating cells (AID - green) are surrounded by myeloid cells (yellow) that we know can trap and display Ag …. just like follicular dendritic cells trap Ab-Ag complexes AID+ Myeloid (Saunders et. al. Dev. Comp. Imm. 2010)

  34. Using laser capture microscopy & RT-PCR we verified that fish GC-like also have TH-cells and cells like follicular dendritic cells www.hcnr.med.harvard.edu/.../lcm_steps.jpg www.dba.med.sc.edu/price/irf/images/lcma.jpg (Saunders et. al. Dev. Comp. Imm. 2010)

  35. Early vertebrates controlled where AID was expressed & had selection! The level of control looks like what happens in human autoimmunity Can we use fish as a model for how autoimmune GCs function?

  36. Where did AID & hypermutation come from? AID-like molecule in agnathans generates the 1° VLR repertoire Carried over to gnathostomes by the common ancestor? Vertebrates may have first used AID to generate the 1° Ig repertoire precedence in rabbits & sheep using AID to diversify their Ig sharks diversify their g-TCR by somatic hypermutation!! It could be imagined as the first means to create a repertoire …. …. but with what caveat?

More Related