Valproic acid in SMA

1. Valproic acid in SMA Brunhilde Wirth Institute of Human Genetics University of Cologne, Germany

2. DNA Intron 2 Exon 3 Exon 1 Intron 1 Exon 2 GT…AG GACTTCAGA GT...AG AGTTTTAGA ACTAGACA Transkription Prä-mRNA ACUAGACA GACUUCAGA GU…AG AGUUUUAGA GU…AG Spleißen mRNA ...GACUUCAGA AGUUUUAGA ACUAGACAA... Translation Protein D F R S F R T R Q From Gene to protein

3. Exons 1 2a 2b 3 4 5 6 7 8 DNA pre-mRNA 1 -5 6 7 8 100% SMN1 10% SMN2 FL-SMN 1 -5 6 8 SMN7 90% SMN2 Protein mRNA SMN genes, transcripts and proteins

4. Exonic splicing enhancer Splice donor Splice aceptor SF2-ASF SF2-ASF Cartegni & Krainer, Nat Genet 2002 Alternative splicing of SMN2 RNA SMN1 …AGgt …ttattttccttacagGGTTTCAGACAAAATCAAAAAGAAGGAAGG… E8 E6 GGTTTTAGACAAAATCAAAAAGAAGGAAGG… SMN2

5. Correct splicing of SMN2 is restored by overexpression of Htra2-β1 and Hra2-β1 interacting splicing factors Htra2-β1 pSMN2 Minigen 5 3 1 0 6 7 8 pSMN2 FL-SMN Δ7-SMN hnRNP-G 4x Increase of FL-SMN2 SRp30c Htra2-β1 * GGUUUCAGACAAAAUCAAAAAGAAGGAAGGUGCUCACAUUCCUUAAAUUAAGGA SE1 SE3 SE2 Hofmann et al., PNAS 2000; Hofmann and Wirth; Hum Mol Genet 2002

6. How to increase the SMN2 protein expression ?

7. #1: transcriptional activation of SMN2 2x increase FL-SMN 20% SMN2 SMN7 80% SMN SMN SMN SMN SMN SMN SMN SMN #2: correction of SMN2 splicing pattern FL-SMN 40% FL-SMN 20% SMN2 SMN7 80% SMN7 40% Htra2-ß1 Therapeutical strategies for SMA

8. HDAC inhibitors • 1. Short chain fatty acids • Valproic acid (VPA) • Phenylbutyrate (BP) • Sodium butyrate (NaBu) • 2. Hydroxamic acids • TSA • SAHA • 3. Benzamides • MS275 • M344 VPA SAHA M344

9. HDACinhibitors HDAC inhibitors activate gene transcription transcription no methylation acetylation methylation no acetylation

10. Rational for valproic acid as a potential therapy for SMA • Treatment of SMA with butyrate • Chang et al. PNAS (2001) short chain fatty acid, HDAC inhibitor BUT: very short half life in vivo (6 min in serum) • Valproic acid (VPA): • another short chain fatty acid, HDAC inhibitor • Phiel et al. J Biol Chem (2001), Göttlicher et al. Embo J (2001) FDA approved drug, successfully used in epilepsy treatment for decades, half life 8 to 10 h in human serum

11. SMA I 3 SMN2copies SMA II 3 SMN2copies SMA I 2SMN2 copies β-Tubulin SMN 5 µM 5 µM 5 µM Mock Mock Mock 50 µM 50 µM 50 µM 0.5 µM 0.5 µM 0.5 µM 500 µM 500 µM 500 µM 1000 µM 1000 µM 1000 µM SMN maximum fibroblast line ML-5 fibroblast line ML-17 fibroblast line ML-16 1.8x 3.0x 3.6x VPA increases SMN protein levels depending on the SMN2 copy number SMN maximum 2.7x 3.1x 4.3x Brichta et al., Hum. Mol. Genet. 2003,19, 2481-2489

12. SMA I 3 SMN2copies SMA I 2 SMN2 copies SMA II 3 SMN2copies β-Tubulin Htra2- β1 5 µM 5 µM 5 µM Mock Mock Mock 50 µM 50 µM 50 µM 0.5 µM 0.5 µM 0.5 µM 500 µM 500 µM 500 µM 1000 µM 1000 µM 1000 µM fibroblast line ML-17 fibroblast line ML-16 fibroblast line ML-5 VPA mediates reversion of Δ7-SMN2 RNA into FL-SMN2 RNA via Htra2-β1 Htra2-β1 maximum 2.7x 2.7x 4.1x Brichta et al., Hum. Mol. Genet. 2003,19, 2481-2489

13. Mechanism of action of valproic acid on the SMN2 gene • The SMN2 transcription level is increased by promotor activation most likely through AP1 and Sp1 elements • Δ7-SMN2 RNA is restored into FL-SMN2 RNA most likely due to increased levels of Htra2-ß1 Brichta et al., Hum. Mol. Genet. 2003,19, 2481-2489

14. Drug validation RAT hippocampal brain slices HUMAN hippocampal brain slicesderived from epilepsy surgery ß-actin (42 kDa) ß-actin (42 kDa) rat smn (40 kDa) human SMN (40 kDa) VPA control VPA control Brichta et al., Hum Mol Genet. 2003; Hahnen et al.,submitted

15. SMA I 3 SMN2 copies β-Tubulin SMN 1 µM 5 µM Mock 10 µM 0.5 µM 0.05 µM SMN maximum 24h fibroblast line ML-16 3.0x SAHA increases SMN protein level in SMA fibroblasts SAHA - Transcription activation - Very modest correction of splicing Hahnen et al., submitted

16. Drugvalidation Human brain slices derived from epilepsy surgery P1 P2

17. SMA I 3 SMN2 copies β-Tubulin SMN 5 µM Mock 10 µM 30 µM 50 µM 0.5 µM 100 µM 64h SMN maximum fibroblast line ML-16 3x Treatment of SMA fibroblasts with M344 M344 Hahnen et al.,submitted

18. Treatment of rat cultured motor neurons with VPA,M344 and SAHA Hahnen et al., submitted

19. Clinical trial with VPA in SMA parents • 10 parents of type I-III SMA patients • All have one SMN1 and 1-3 SMN2 copies. • Treatment for about 4-5 months (70-80 µg VPA/ml serum) • 9 measurements of SMN2-RNA and SMN-protein from blood samples Results: 6/10 showed an increase of FL-SMN between 40-300% • Therapy with VPA in SMA patients

20. Individual therapy of SMA patients with VPA • Individual therapies of about 40 type I-III SMA patients (seen by various neuropediatricians, neurologists, pediatricians in Germany and Austria) • Patients have a level of VPA in serum of ~70-80µg/ml • Most patients were also substituted with L-carnitin (50-100 mg/kg/day) • The younger the patients are the more improvements were reported • First improvements usually after ~6 months of therapy • There were no significant negative side effects reported so far • Results of quantitative measurements of FL-SMN showed an up-regulation in about 50% of patients

21. Future trials with VPA • Germany: type I SMA patients • Extinction on European level • USA: type II and III SMA patients • Starts in June 2005 • EU: type II SMA patients • Planed, next meeting of the ENMC in autumn

22. Initiative “Forschung und Therapie für SMA” SMA-Germany Cologne Lars Brichta Eric Hahnen Markus RiesslandIrmgard Hölker Bonn Yvonne Hofmann Karsten Haug Yuli Sun Heidrun Raschke Thomas Klockgether Sebastian Stier Erlangen Florian Siebzehnrubl Ingmar Blümcke Ilker Eyupoglu Hannover Kirsten Haastert Peter Claus ZMMK Köln Fortune