1 / 9

Answers to Biotech Jeopardy

Answers to Biotech Jeopardy. Biotechnology Test Review Questions: Easy Small, circular piece of bacterial DNA is called a ____. Give two examples of vectors: The entire collection of genes within human cells is called the _______________. Difference between technology and biotechnology?

elijah-erickson
Download Presentation

Answers to Biotech Jeopardy

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Answers to Biotech Jeopardy

  2. Biotechnology Test Review Questions: • Easy • Small, circular piece of bacterial DNA is called a ____. • Give two examples of vectors: • The entire collection of genes within human cells is called the _______________. • Difference between technology and biotechnology? • Function of restriction enzymes? • HGP stands for? How many base pairs in HG? How many proteins? • Difference between surrogate and biological mother? • A _____________ is caused by a defective or mutant gene. • Define gene. • The first cell created by sexual reproduction is called a

  3. Biotechnology Test Review Questions: • Easy • Small, circular piece of bacterial DNA is called a ____. • Give two examples of vectors: • The entire collection of genes within human cells is called the _______________. • Difference between technology and biotechnology? • Function of restriction enzymes? • HGP stands for? How many base pairs in HG? How many proteins? • Difference between surrogate and biological mother? • A _____________ is caused by a defective or mutant gene. • Define gene. • The first cell created by sexual reproduction is called a

  4. Medium • 1. Inserting unrelated pieces of DNA together will result in ____________________. • 2. IVF stands for? What is a synonym used for IVF? • 3. What does transgenic mean? • 4. Identical twins are considered to be genetic ___________. • 5. How does IVF work? What does the female have to do? What does the male have to do? • 6. Why does IVF sometimes result in twins, triplets, or quads? • 7. Difference between fraternal vs. identical twins? • 8. How does Gel Electrophoresis separate DNA fragments? • 9. What is an example of a genetic disease? • 10. What kind of ethical questions arise from IVF?

  5. Medium • 1. Inserting unrelated pieces of DNA together will result in ____________________. • 2. IVF stands for? What is a synonym used for IVF? • 3. What does transgenic mean? • 4. Identical twins are considered to be genetic ___________. • 5. How does IVF work? What does the female have to do? What does the male have to do? • 6. Why does IVF sometimes result in twins, triplets, or quads? • 7. Difference between fraternal vs. identical twins? • 8. How does Gel Electrophoresis separate DNA fragments? • 9. What is an example of a genetic disease? • 10. What kind of ethical questions arise from IVF?

  6. Disease Huntington’s disease, sickle cell anemia, cystic fibrosis • Ethical questions • Will anyone be harmed? • What will be done with the extra embryos? • Who will pay the cost? • Do all involved parties agree? • Is it safe for the mother and embryo?

  7. Difficult • What is the difference between gene therapy and genetic engineering? • Difference between a hybrid and chimera? • Steps of genetic engineering? • The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT • What research can be done using gel electrophoresis?

  8. Difficult • What is the difference between gene therapy and genetic engineering? • Difference between a hybrid and chimera? • Steps of genetic engineering? • The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT • What research can be done using gel electrophoresis?

  9. Hybrid has DNA from 2 organism in each cell • Chimera has cells from different organisms in the body

More Related