Genetic Engineering

1. Genetic Engineering Topics Concepts • Agrobacterium • Gene gun • Protoplasts • Anti-sense technology • DNA code is universal • Plants can be transformed • with “foreign” DNA using one • of several methods • Antisense technology can • eliminate a trait • Successful genetic engineering • depends on a plant’s offspring • carrying the new gene Terms • Cloning • Agrobacterium • Plant hormones • Callus

2. Damage done by Lepidoptera Corn borer Gypsy Moths Monarch Butterflies Cabbage Butterflies

3. Bacillus thuringiensis is an effective biocontrol agent Intact bacteria Spore Bt-toxin helios.bto.ed.ac.uk/ bto/microbes/bt.htm

4. Scientists have used genetic engineering to move the Bt-gene into plants

5. CLONING • Cutting and splicing genes • Generating an exact copy • Cells • Organism (i.e potato)

6. CLONING: 2 definitions • Cutting and splicing genes • Generating an exact copy - cells - organism (i.e. potato)

7. Moving the Bt-gene into plants

8. In nature, Agrobacterium carries a Tumor-inducing (Ti) plasmid Genomic DNA Ti-plasmid (tumor-inducing) Agrobacterium

9. The Ti-plasmid carries Transfer DNA (T-DNA) T-DNA Plant promoter Plant hormone genes Opine Synthesis genes

10. Agrobacterium delivers the Transfer DNA (T-DNA) to the plant cell Agrobacterium Plant Cell

11. The Transfer DNA (T-DNA) integrates into to the plant DNA Agrobacterium Plant Cell

12. The Transfer DNA (T-DNA) integrates into to the plant DNA Plant promoter Plant hormone and opine Synthesis genes Plant Cell

13. Agrobacterium forces plant to become a opine factory http://helios.bto.ed.ac.uk

14. In genetic engineering, scientists highjack the Ti-plasmid and clone the Bt-toxin gene into it Ti-plasmid Plant promoter Bt-toxin gene T-DNA

15. The Transfer DNA (T-DNA) integrates into to the plant DNA T-DNA + Bt-toxin gene Agrobacterium Plant Cell

16. Goal: To get your gene of interest into every cell of a plant If you want to sell your genetically modified seed – EVERY seed needs to have the “new” gene

17. 3 ways to get your gene into every plant cell • Use Agrobacterium to transform the gametes of a plant, then grow a plant from the seeds after pollination. • Use Agrobacterium to transform plantprotoplasts, then regenerate plants from those cells. • Use gene gun to transform plantcells, then regenerate plants from those cells.

18. Genetically engineering plants: floral dip Flowers Dip flowers in a solution of Agrobacterium (with your gene plus herbicide- resistance gene)

19. Agrobacterium can move into pistil and specifically transform the ovules (gametes) Bent lab, U. of Wisconsin

20. Transforming plants: floral dip Flowers Dip flowers in a solution of Agrobacterium (with your gene plus herbicide- resistance gene) Seeds growing on herbicide: only seeds with herb.-resistance can grow Seed pods Bent lab, U. of Wisconsin

21. Only Seedlings with T-DNA integrated into their own DNA can survive in presence of herbicide EH, U. of Wisconsin Success Rate = 1/ 3000

22. Floral dip transformation has only been successful for a few plants (dicots)

23. 3 ways to get your gene into every plant cell • Use Agrobacterium to transform the gametes of a plant, then grow a plant from the seeds after pollination. • Use Agrobacterium to transform plantprotoplasts, then regenerate plants from those cells. • Use gene gun to transform plantcells, then regenerate plants from those cells.

24. Piece of Potato Leaves J. Helgeson, UW-Madison

25. Protoplasts Released from Leaves (cell walls stripped) See 541-542 in Life

26. Transform protoplasts with Agrobacterium T-DNA (engineered withgene of interest plus herbicide-resistance gene) Agrobacterium cell

27. Grow protoplasts in a plant medium that contains: • Plant hormones (to stimulate cell division and differentiation) • Herbicide (to prevent non-engineered cells from growing)

28. Clumps of plant cells grow (called callus). Only cells with herbicide-resistance gene will grow.

29. New plant will grow from callus

30. New plant will grow from callus

31. New plant will grow from callus … and every cell will contain your gene of interest...

32. …including the gametes which will provide the gene to the next generation.

33. 3 ways to get your gene into every plant cell • Use Agrobacterium to transform the gametes of a plant • Use Agrobacterium to transform plant protoplasts (stem cells) and regenrate plants from those cells • Use gene gun to transform plant cells and regenerate plants from those cells

35. Transform plant cells directly with gene gun (especially monocots) Plant cell Gold beads covered with DNA from your gene of interest + herbicide-resistance gene

36. Gene gun

37. The gene gun can be used to shoot callus. Then regenerate a plant from transformed callus tissue. (Grow it in a medium with plant hormones & herbicide.)

38. Steps in Genetic Engineering Step 1: Isolate your gene of interest. Step 2: Clone into a Ti-plasmid:your gene of interest plus an herbicide-resistance gene. Step 3: Transform your plant the altered Ti-plasmid. Step 4: Regenerate entire plant from transformed cells, callus, or seeds.

39. Subtracting a trait: Flavor Savor Tomato

40. Softening is due to destruction of pectin Pectin: Cell rigidity PG Polygalacturonase

41. Softening is due to destruction of pectin Pectin: Cell rigidity PG Polygalacturonase

42. Antisense Technology: How to prevent PG enzyme from being made SENSE ANTISENSE P TATATACGAAGGCAC…… ATATATGCTTCCGTG…… TACGAAGGCAC..TATA ATGCTTCCGTG…ATAT P AUGCUUCCGUG UACGAAGGCAC… AUGCUUCCGUGUACGAAGGCAC Double stranded RNA cannot be translated because it binds with antisense mRNA.

43. Antisense Technology Tomato plants carrying the antisense PG gene showed 95% reduction in PG enzyme. These Flavr-Savr tomatoes ripened on the vine but stayed firm for a longer period of time.

44. Issues in Genetic Engineering What are the impacts of genetic engineering? • Biological or environmental • Socio-economic • Political or legislative