Nucleic acids and enzymes

1. Lecture 3 Nucleic acids and enzymes The nuts and bolts Most by David Tscharke @ RSB

2. Lecture overview • How to ‘read’ DNA • Different types of nucleic acids • Cutting DNA by restriction enzymes • Synthetic DNA • Enzymes used in molecular biology • - polymerases, nucleases, ligase, phosphatases, kinases

3. 5’ 5’ 3’ 3’ P m P P m m P P m m P P m m A C T G P m C A G T DNA is a polymer of 2 long chain polymers… Modified from Lodish 5th, 4-3 (b)

4. … but the chemistry is easy to forget! cattatgataagtacccttatattcacaaatatgatggtgatgagcgacaatattctattactgcagagggaaaatgctataaaggaataaaatatgaaataagtatgatcaacgatgatactctattgagaaaacatactcttaaaattggatctacttatatatttgatcgtcatggacatagtaatacatattattcaaaatatgatttttaaaaatttaaaatatattatcacttcagtgacagtagtcaaataacaaacaacaccatgagatatattataattctcgcagttttgttcattaatagtatacacgctaaaataactagttataagtttgaatccgtcaattttgattccaaaattgaatggactggggatggtctatacaatatatcccttaaaaattatggcatcaagacgtggcaaacaatgtatacaaatgtaccagaaggaacatacgacatatccgcatttccaaagaatgatttcgtatctttctgggttaaatttgaacaaggcgattataaagtggaagagtattgtacgggactatgcgtcgaagtaaaaattggaccaccgactgtaacattgactgaatacgacgaccatatcaatttgtacatcgagcatccgtatgctactagaggtagcaaaaagattcctatttacaaacgcggtgacatgtgtgatatctacttgttgtatacggctaacttcacattcggagattctaaagaaccagtaccatatgatatcgatgactacgattgcacgtctacaggttgcagcatagactttgtcacaacagaaaaagtgtgcgtgacagcacagggagccacagaagggtttctcgaaaaaattactccatggagttcgaaagtatgtctgacacctaaaaagagtgtatatacatgcgcaattagatccaaagaagatgttcccaatttcaaggacaaaatggccagagttatcaagagaaaatttaataaacagtctcaatcttatttaactaaatttctcggtagcacatcaaatgatgttaccacttttcttagcatgcttaacttgactaaatattcataactaatttttattaatgatacaaaaacgaaataaaactgcatattatacactggttaacgcccttataggctctaaccattttcaagatgaggtccctgattatagtccttctgttcccctctatcatctactccatgtctattagacaatgtgagaagactgaagaggaaacatggggattgaaaatagggttgtgtataattgccaaagatttctatcccgaaagaactgattgcagtgttcatctcccaactgcaagtgaaggattgataactgaaggcaatggattcagggatatacgaaacaccgataaattataaaaaaagcaatgtgtccgctgtttccgttaataatactattttcgtaactggcggattattcataaataactctaatagcacgatcgtggttaacaatatggaaaaacttgacatttataaagacaaacaatggtcgattatagaaatgcctatggctagggtatatcacggcatcgactcgacatttggaatgttatattttgccggaggtctatccgttaccgaacaatatggtaa

5. 5 million bp in E. coli – 0.5 million characters in average book

6. Working with DNA sequences Sequence gets written like this: 1 AAAAATTATT GATGTCTACA CATCCTTTTG TAATTGACAT CTATATATCC 51 TTTTGTATAA TCAACTCTAA TCACTTTAAC TTTTACAGTT TTCCCTACCA 101 GTTTATCCCT ATATTCAACA TATCTATCCA TATGCATCTT AACACTCTCT 151 GCCAAGATAG CTTCAAAGTG AGGATAGTCA AAAAGATAAA • Questions: • Is this DNA or RNA? • Which is the 5’ end? • Do you need to mark the 5’ end?

7. 5’ 3’ TTTGTAATAA CTACAGATGT 3’ 5’ Working with DNA sequences 2 Sequence gets written like this: AAACATTATT GATGTCTACA • Question: • What is the sequence of the complementary strand? • A)TTTGTAATAA CTACAGATGT • B)TGTAGACATC AATAATGTTT Where do you look if you want to predict the amino acid sequence of the protein?

8. Working with DNA sequences SUMMARY DNA sequence is often written as a single strand - but don’t forget the other one DNA is ALWAYS written 5’ to 3’ - except the bottom strand if both strands are written In CHEM2208, you will ALWAYS lose marks for writing DNA 3’ -> 5’even if it is labelled You can predict protein sequence from DNA sequence - proteins may be encoded by the complementary strand - remember to read 5’ -> 3’

9. Sense and antisense • The sense strand of a gene has the SAME nucleotide sequence as the mRNA • the antisense strand is complementary to the sense strand • The sense strand of one gene may be the antisense strand of another • Overlapping genes are common in E. coli Triplets of gene A 5’ AAACATTATTGGTGTCTACA 3’ 3’ TTTGTAATAACCACAGATGT 5’ Triplets of gene B

10. How does E. coli identify the reading frames By a Shine-Dalgarno sequence 10-12 nucleotides prior the start codon Lynn Dalgarno John Shine

11. Ribosome binding site (Shine-Dalgarno) • Ribosome binding site (RBS) • About 10 nucleotides prior to AUG start codon • Complementary to 16S rRNA of the ribosome • Promotes binding of the ribosome to the mRNA • E. coli consensus RBS is AGGAGGU

12. Ribosome with mRNA Showing the rRNA of the 30S subunit after stripping most proteins Shine-Dalgarno helix involving 16S RNA

13. Several start codons are possible in E. coli • The classical start codon is AUG (or ATG in DNA; also codes for methionine) • Start codons in E. coli: • ATG (83%) • GTG (14%) • TTG (3%) • ATT and CTG (rare) • A start codon always gets translated as methionine even if the codon normally encodes a different amino acid • A separate tRNA is used for initiation

14. Types of nucleic acid • DNA • genomic • plasmids • PCR products and cDNAs • chemically synthesised DNA • (oligonucleotides) • RNA • messenger (mRNA) • transfer (tRNA) • ribosomal (rRNA) • ribozymes • virus genomes

15. Messenger RNA As little as 2 – 5 % of total cellular RNA by weight Lengths from 100s to 1000s of bps - can be extracted intact Unstable (all forms of RNA) - largely due to the ubiquitous presence of RNases Convert to cDNA for sequencing and expression

16. Genomic DNA

17. Genomic DNA • Bacterial DNA does not have nucleosomes • Protein HU • stabilizes left-handed and right-handed supercoiling • there is less of it and its structure is completely different from nucleosomes Macvanin and Adhya, BBA 2012

18. In your tube after extraction Genomic DNA Conditions before extraction affect integrity Too much shearing during extraction (e.g. vigorous stirring) leads to breaks

19. Plasmid DNA • Extrachromosomal (or episomal) circles of DNA • Found in bacteria and ‘lower’ eukaryotes • yeast has them, mammals do not • Replication is independent of genome • Relatively small • Thousands rather than millions of base pairs • remains intact after extraction • Exists in various states of supercoiling • - supercoiled, closed relaxed circular, • open circular, linear • Small plasmids are easy to manipulate

20. Gene • Segment of DNA coding for protein or (functional) RNA

21. Restriction endonucleases • AKA ‘Restriction enzymes’ • Recognise dsDNA sequences 4-8 base pairs long • Cut both strands • Restriction/modification systems provide anti-viral immunity • to bacteria • Type II (and IIS) used in molecular biology • Cutting and modification are done by different enzymes • Cut the DNA within (type II) or outside (IIS) the recognition • site • Cut ends have 5’-phosphate groups

22. C T T A A G 2-fold axis of symmetry (rotational) site of cleavage Type II Restriction enzymes : EcoRI GA A T T C This kind of sequence is called a palindrome! It is different to a palindrome in language The phosphate ester groups stay on the 5’ ends

23. Restriction cutting can give different ends EcoRI 5’ GAATTC G AATTC 3’ CTTAAG CTTAA G 5’ overhang 5’ protruding 5’ sticky SmaI 5’ CCCGGG CCC GGG 3’ GGGCCC GGG CCC blunt PstI 3’ overhang 3’ protruding 3’ sticky 5’ CTGCAG CTGCA G 3’ GACGTC G ACGTC Ends can be re-joined by ligase if the 5’phopshate is intact (later lecture)

24. Isoscizomers Enzymes with the same recognition sequence - May not cut in the same place G CATG▼CC▲GTAC G Sph I & Bbu I CCC▼GGGGGG▲CCC C▼CCGG GG GGCC▲C Sma I Xma I ▼GATC  CTAG▲ G*A▼ T CC T▲*AG Sau3A I, Mbo I & Nde II Dpn I

25. Question time How are restriction enzymes named? HindIII 3rd from Haemophilus influenzae, d EcoRI 1st from Eschericia coli, R BglII 2nd from Bacillus globigii BamHI 1st from Bacillus amyloliquefaciens, H PstI 1st from Providencia stuartii SexAI 1st from Streptomyces exfoliatus

26. How many are there, what do they cost?

28. Biotech shopping list • Polymerases • Nucleases • Endo- and exo- • Ligases • Kinases • Phosphatases

29. Enzymes If DNA is the building material, enzymes are the tools Need the right conditions of salt and temperature Some need extras, such as ATP or metal ions (Mg2+) Some are stable, most are destroyed by heat • Or even leaving out of the freezer for a few hours Most are stored in buffer containing glycerol • Keeps them liquid at -20 ºC • Saves them from freeze/thaw cycles • BUT limits the amount you can use http://www.vivo.colostate.edu/hbooks/genetics/biotech/enzymes/index.html

30. Chemically synthesised DNA Oligonucleotides or ‘oligos’ Used extensively in molecular biology - primers for PCR - synthetic genes ssDNA Lack 5’ phosphate - unless you ask

31. Silica bead Silica bead Silica bead Chemical synthesis of DNA Deblocking Activation & Coupling Capping (unreacted) Oxidation Glick pp91-95

32. 90% 95% 98% 99% Errors add up coupling efficiency 100 overall yield of desired product (%) 80 60 40 20 0 0 20 40 60 80 100 Length of desired product (bp) The relationship is exponential

33. Chemical DNA synthesis Can make any length - ssDNA or dsDNA - 5’ phosphate costs extra Around $0.5 a base for most applications Up to 30-mer usually OK to have unpurified for many (but not all) applications - purification by HPLC or gel methods (for correct size) May get occasional base substitutions - even if purified by gel, can have some errors (if not checked by sequencing)

34. Summary of nucleic acid section Need to remember your chemistry - ssDNA lacking a 5’ phosphate Different nucleic acids have different properties - can be the basis for separations / purification DNA can be made chemically - only efficient for short bits (<100 bp) - always have some copies with errors

35. Molecular biology shopping list • Polymerases • Nucleases • Endo- and exo- • Ligases • Kinases • Phosphatases

36. Polymerases All add nucleotides in a 5’ -> 3’ direction Examples: • Klenow fragment, Taq and Pfu polymerases - DNA-dependent DNA polymerase • Reverse transcriptase - RNA-dependent DNA polymerase • T7 and SP6 phage RNA polymerases - RNA-dependent RNA polymerase Many have extra functions - Some proof-read (3’ -> 5’ exonuclease activity) - Some are also terminal transferases

37. DNA pol 5’ 3’ All polymerases need ‘priming’ ? ! 3’ 5’ Also need the building blocks… dATP, dCTP, dGTP and dTTP (often called dNTPs)

38. Primers in molecular biology Primers direct the start of DNA synthesis Great… as long as you know the sequence Synthetic oligonucleotides most commonly used Must get conditions right for primer hybridisation AND polymerase activity - primers must have the right length for desired specificity

39. Endonucleases and Exonucleases 5’ 3’ Exo Exo 3’ 5’ Endo Cleave one or more phosphodiester bonds Restriction endonucleases are some of the most important tools in biotechnology • Cleave both strands of dsDNA at a specific sequence • We’re going there next lecture… In general they are the enemy, when controlled are very useful

40. Ligase Ligase Ligase repairs broken phoshodiester bonds • Uses ATP (one for each bond repaired) • Most common enzyme for joining DNA in vitro • Needs 5’-phosphate from Lodish Fig 9-11

41. Phosphatases / kinases 5’ 3’ P P 3’ 5’ ADP alkaline phosphatase polynucleotide kinase ATP ATP 5’ 3’ 3’ 5’

42. Enzymes Summary Naturally ocurring enzymes supply all the tools to: Make DNA or RNA (biologically, in vitro) • polymerases Cut nucleic acid or degrade it • nucleases Join DNA • ligases Mess with the ends of DNA to alter joining • kinase / phosphatase Never assume: 1) they only do exactly what you want 2) they do it with 100% efficiency