1 / 16

Environmental Signal Integration by a Modular AND Gate

Environmental Signal Integration by a Modular AND Gate. By J Christopher Anderson, Christopher A Voigt and Adam P Arkin. Presented by Alexandra Doolittle for 20.385 02.16.2010. Hypothesis. AND Gates can be used to integrate environmental information

ganit
Download Presentation

Environmental Signal Integration by a Modular AND Gate

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Environmental Signal Integration by a Modular AND Gate By J Christopher Anderson, Christopher A Voigt and Adam P Arkin Presented by Alexandra Doolittle for 20.385 02.16.2010

  2. Hypothesis • AND Gates can be used to integrate environmental information • The AND gate is modular since promoters comprise both the inputs and output of the system

  3. The AND Gate Input A- Promoter which controls the Transcription of T7 RNA Polymerase (mod - 2 amber STOP codons) Input B- Promoter which controls the amber suppressor tRNA supD Output - T7 RNA is synthesized and activates T7 promoter

  4. AND Gate to Translate T7 RNA Polymerase Resulting in GFP Expression

  5. Common Genetic Circuit Problem - Impedance Matching Construct 1: GFP was produced in the absence of salicate. Rbs for PBAD was strong enough to produce T7 poly output GFP Input T7 Poly

  6. Saturation Mutation Library for PBAD • Parental GGAGGAATTAACCATG • Libraryb NNNGGAATTAACCRTG • B9 CTAGGAATTAACCGTG • F11 AAAGGAATTAACCGTG • MgrB AAAGGAATTAACCATG • Salc TCAGGAGTCATCATTATTTATG

  7. B9 Characterization through Fluorimetry and Flow Cytommetry • Visualised 64 combinations of inducers through Fluorimetry • 1000 fold induction between on and off states.

  8. Transfer Function • steady state response of the system as a function of the activity of the input promoters • Can understand how the input promoters affect the function • Black Box Model: levels of input output • I1 and I2 represent PBAD and Psal

  9. Transfer Function Characterization for Each Promoter • Currently - use mutation and screening to determine the best rbs strength • Now- use the transfer function to determine the strength of rbs needed

  10. B9 Transfer Function Data Fit to determine a and b • a = 50 • b = 3000

  11. Range of Output Possibilities • B9 and F11 visualization of input strength to output • Demonstrates the entire range of possibilities. • Movement of the white box determined via rbs strength

  12. AND Gate Modularity

  13. Critique • Transfer Function - based on steady state. Fails to take into account dynamic system responses. • Black Box model to simple. • Cell characteristics could affect the response • Nutrient levels • Temperature • Phase of Growth

  14. Why Do We Care? • Integrating multiple signals from the environment can increase sensing specificity. • Can identify new environments where there is not a strong recognizable single symbol. • The modularity allows the circuit to be attached to multiple inputs and outputs.

  15. Why Do We Care? • Transfer function can be used to predict strength levels of the inputs to produce a functional system. • Other potential Regulators: • Nonsense, missense and frameshift regulators • riboregulators

  16. Going Farther. • Beijing iGEM 2009 - Used the and gate to create conditional memory in ecoli • Biosensors - respond to changes in the environment. • A stop growth switch in cells when certain nutrients are lacking

More Related