MOLECULAR GENETICS CLASS SESSIONS: 1. DNA, Genes, Chromatin

1. MOLECULAR GENETICS CLASS SESSIONS: 1. DNA, Genes, Chromatin 2. DNA Replication, Mutation, Repair 3. RNA Structure and Transcription 4. Eukaryotic Transcriptional Regulation 5. CLASS DISCUSSION – GENETIC DISEASES 6. RNA Processing 7. Protein Synthesis and the Genetic Code 8. Protein Synthesis and Protein Processing 9. CLASS DISCUSSION – GENETIC DISEASES 10. DNA Cloning and Isolating Genes

2. THE FLOW OF GENETIC INFORMATION 2 3 DNA RNA PROTEIN 1 DNA 1. REPLICATION (DNA SYNTHESIS) 2. TRANSCRIPTION (RNA SYNTHESIS) 3. TRANSLATION (PROTEIN SYNTHESIS)

3. DNA Structure and Chemistry a). Evidence that DNA is the genetic information i). DNA transformation – know this term ii). Transgenic experiments – know this process iii). Mutation alters phenotype – be able to define genotype and phenotype b). Structure of DNA i). Structure of the bases, nucleosides, and nucleotides ii). Structure of the DNA double helix iii). Complementarity of the DNA strands c). Chemistry of DNA i). Forces contributing to the stability of the double helix ii). Denaturation of DNA

4. Structures of the bases Purines Pyrimidines Adenine (A) Thymine (T) 5-Methylcytosine (5mC) Guanine (G) Cytosine (C)

5. Nucleoside [structure of deoxyadenosine] Nucleotide

6. Nomenclature Nucleoside Nucleotide Base +deoxyribose +phosphate Purines adenine adenosine guanine guanosine hypoxanthine inosine Pyrimidines thymine thymidine cytosine cytidine +ribose uracil uridine

7. ii). Structure of the DNA double helix Structure of the DNA polynucleotide chain 5’ 3’ • polynucleotide chain • 3’,5’-phosphodiester bond

8. A-T base pair Hydrogen bonding of the bases G-C base pair Chargaff’s rule: The content of A equals the content of T, and the content of G equals the content of C in double-stranded DNA from any species

9. Double-stranded DNA 5’ 3’ Major groove Minor groove “B” DNA 3’ 5’ 3’ 5’

10. Chemistry of DNA • Forces affecting the stability of the DNA double helix • hydrophobic interactions - stabilize • - hydrophobic inside and hydrophilic outside • stacking interactions - stabilize • - relatively weak but additive van der Waals forces • hydrogen bonding - stabilize • - relatively weak but additive and facilitates stacking • electrostatic interactions - destabilize • - contributed primarily by the (negative) phosphates • - affect intrastrand and interstrand interactions • - repulsion can be neutralized with positive charges • (e.g., positively charged Na+ ions or proteins)

11. Stacking interactions Charge repulsion Charge repulsion

12. Model of double-stranded DNA showing three base pairs

13. Denaturation of DNA Strand separation and formation of single-stranded random coils Double-stranded DNA Extremes in pH or high temperature A-T rich regions denature first Cooperative unwinding of the DNA strands

14. Electron micrograph of partially melted DNA Double-stranded, G-C rich DNA has not yet melted A-T rich region of DNA has melted into a single-stranded bubble • A-T rich regions melt first, followed by G-C rich regions

15. Hyperchromicity Absorbance maximum for single-stranded DNA Absorbance maximum for double-stranded DNA Absorbance 220 260 300 The absorbance at 260 nm of a DNA solution increases when the double helix is melted into single strands.

16. DNA melting curve 100 50 Percent hyperchromicity 0 50 70 90 Temperature oC • Tm is the temperature at the midpoint of the transition

17. Tm is dependent on the G-C content of the DNA E. coli DNA is 50% G-C Percent hyperchromicity 50 60 70 80 Temperature oC Average base composition (G-C content) can be determined from the melting temperature of DNA

18. Genomic DNA, Genes, Chromatin a). Complexity of chromosomal DNA i). DNA reassociation ii).Repetitive DNA and Alu sequences iii). Genome size and complexity of genomic DNA b). Gene structure i). Introns and exons ii). Properties of the human genome iii). Mutations caused by Alu sequences c). Chromosome structure - packaging of genomic DNA i). Nucleosomes ii). Histones iii). Nucleofilament structure iv). Telomeres, aging, and cancer

19. DNA reassociation (renaturation) Double-stranded DNA Denatured, single-stranded DNA Faster, zippering reaction to form long molecules of double- stranded DNA k2 Slower, rate-limiting, second-order process of finding complementary sequences to nucleate base-pairing

20. DNA reassociation kinetics for human genomic DNA Cot1/2 = 1 /k2 k2 = second-order rate constant Co = DNA concentration (initial) t1/2 = time for half reaction of each component or fraction Kinetic fractions: fast intermediate slow 0 fast (repeated) intermediate (repeated) Cot1/2 % DNA reassociated 50 Cot1/2 slow (single-copy) Cot1/2 100 I I I I I I I I I log Cot

21. 106 copies per genome of a “low complexity” sequence of e.g. 300 base pairs 1 copy per genome of a “high complexity” sequence of e.g. 300 x 106 base pairs high k2 low k2

22. Type of DNA % of Genome Features Single-copy (unique) ~75% Includes most genes 1 Repetitive Interspersed ~15% Interspersed throughout genome between and within genes; includes Alu sequences 2 and VNTRs or mini (micro) satellites Satellite (tandem) ~10% Highly repeated, low complexity sequences usually located in centromeres and telomeres 2Alu sequences are about 300 bp in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes in introns or nontranslated regions. 1 Some genes are repeated a few times to thousands-fold and thus would be in the repetitive DNA fraction 0 fast ~10% intermediate ~15% 50 slow (single-copy) ~75% 100 I I I I I I I I I

23. Classes of repetitive DNA Interspersed (dispersed) repeats (e.g., Alu sequences) GCTGAGG GCTGAGG GCTGAGG Tandem repeats (e.g., microsatellites) TTAGGGTTAGGGTTAGGGTTAGGG

24. Genome sizes in nucleotide pairs (base-pairs) plasmids viruses bacteria fungi plants algae insects mollusks bony fish The size of the human genome is ~ 3 X 109 bp; almost all of its complexity is in single-copy DNA. The human genome is thought to contain ~30,000 to 40,000 genes. amphibians reptiles birds mammals 104 105 106 107 108 109 1010 1011

25. Gene structure promoter region exons (filled and unfilled boxed regions) +1 introns (between exons) transcribed region mRNA structure 5’ 3’ translated region

26. The (exon-intron-exon)n structure of various genes histone total = 400 bp; exon = 400 bp b-globin total = 1,660 bp; exons = 990 bp HGPRT (HPRT) total = 42,830 bp; exons = 1263 bp factor VIII total = ~186,000 bp; exons = ~9,000 bp

27. Properties of the human genome • Nuclear genome • the haploid human genome has ~3 X 109 bp of DNA • single-copy DNA comprises ~75% of the human genome • the human genome contains ~30,000 to 40,000 genes • most genes are single-copy in the haploid genome • genes are composed of from 1 to >75 exons • genes vary in length from <100 to >2,300,000 bp • Alu sequences are present throughout the genome • Mitochondrial genome • circular genome of ~17,000 bp • contains <40 genes

28. Alu sequences can be “mutagenic” • Familial hypercholesterolemia • autosomal dominant • LDL receptor deficiency From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.

29. LDL receptor gene Alu repeats present within introns 4 5 6 Alu repeats in exons unequal crossing over 4 5 6 Alu Alu X Alu Alu 4 5 6 one product has a deleted exon 5 (the other product is not shown) Alu 4 6

30. Chromatin structure EM of chromatin shows presence of nucleosomes as “beads on a string”

31. Nucleosome structure • Nucleosome core (left) • 146 bp DNA; 1 3/4 turns of DNA • DNA is negatively supercoiled • two each: H2A, H2B, H3, H4 (histone octomer) • Nucleosome (right) • ~200 bp DNA; 2 turns of DNA plus spacer • also includes H1 histone

34. Histones (H1, H2A, H2B, H3, H4) • small proteins • arginine or lysine rich: positively charged • interact with negatively charged DNA • can be extensively modified - modifications in • general make them less positively charged • Phosphorylation • Poly(ADP) ribosylation • Methylation • Acetylation • Hypoacetylation • by histone deacetylase (facilitated by Rb) • “tight” nucleosomes • assoc with transcriptional repression • Hyperacetylation • by histone acetylase (facilitated by TFs) • “loose” nucleosomes • assoc with transcriptional activation

35. Nucleofilament structure

36. Condensation and decondensation of a chromosome in the cell cycle

37. telomere centromere telomere Telomeres are protective “caps” on chromosome ends consisting of short 5-8 bp tandemly repeated GC-rich DNA sequences, that prevent chromosomes from fusing and causing karyotypic rearrangements. Telomeres and aging Metaphase chromosome <1 to >12 kb telomere structure (TTAGGG)many young (TTAGGG)few senescent • telomerase (an enzyme) is required to maintain telomere length in • germline cells • most differentiated somatic cells have decreased levels of telomerase • and therefore their chromosomes shorten with each cell division

38. Class Assignment (for discussion on Sept 9th) Botchkina GI, et al. “Noninvasive detection of prostate cancer by quantitative analysis of telomerase activity.” Clin Cancer Res. May 1;11(9):3243-3249, 2005 PDF of article is accessible on the website