1 / 38

Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN

Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN. SIXTH FRAMEWORK PROGRAMME SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS AND BIOTECHNOLOGY FOR HEALTH. Actinomycetes are an important resource for new antibiotics.

gur
Download Presentation

Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Mutagenesis of Actinomycetes Workshop July 11 –15 2005 University of Wales Swansea ActinoGEN SIXTH FRAMEWORK PROGRAMME SIXTH FRAMEWORK PROGRAMME PRIORITY 1 LIFE SCIENCES, GENOMICS AND BIOTECHNOLOGY FOR HEALTH

  2. Actinomycetes are an important resource for new antibiotics • techniques to manipulate actinomycete genes are vital to exploiting this resource • precursor biosynthesis • regulatory networks • antibiotic biosynthetic genes • exemplified in S. coelicolor

  3. Genome sequencing was based on a detailed genetic and physical map

  4. Functional genomics of Streptomyces coelicolor UMIST: Bioinformatics & metabolomics John Innes Centre: Proteomics & Redirect mutagenesis University of Warwick: 20 metabolite analysis University of Wales Swansea: Systematic mutagenesis University of Surrey: microarrays

  5. Mutagenesis • Three techniques that exploit the genome sequence: • In vitro transposon mutagenesis – systematic • (2) In vivo transposon mutagenesis – identify genes of related function • (3) PCR targetting (Redirect) – functional analysis of a set of genes

  6. (1) In vitro ‘shuttle’ transposition • Transposition is (fairly) random • Target site is duplicated and Insertion Sequence integrated Tn5062 [AprR oriT] + Cosmid Target Site Ref: Bishop et al 2004 Genome Research 14: 893-900

  7. In vitro transposon mutagenesis (1) Mutant cosmid isolation cosmid Tn5062 transposase + + In vitro transposition Transform E.coli [AprRKanRAmpR ] Isolate cosmid DNA Sequence

  8. ME RBS gfp T4 T4 oriT ME stop apramycinR Organisation of Tn5062 EZR1 sequencing primer

  9. Analysis of Tn5062 insertions • sequence files are directly processed using Transposon Express software • finds boundary of Tn5062 sequence • compares succeeding sequence with cosmid or genome sequence • reports coordinates of insertion and identity of disrupted gene Ref: Herron et al 2004 Nucleic Acids Res 32: e113

  10. Transposon Express

  11. location and description of each insertion provided at: http://streptomyces.org.uk/S.coelicolor/index.html

  12. Systematic mutagenesis of Streptomyces coelicolor A3(2) • Progress to date: • 105 of 319 cosmids fully processed • 11493 independent insertions • 10459 insertions in 2520 orfs (of 7825 in total) • 4.2 insertions per orf

  13. Advantages of systematic in vitro transposon mutagenesis • High throughput • Conjugation and the recovery of gene replacement clones are efficient, so that many replicate clones are obtained for phenotypic testing • With one insertion per 280 bp, phenotypic analysis of several independent insertions in a given gene obviates the need for linkage analysis • Mutations can be moved into different genetic backgrounds, facilitating analysis of gene interactions

  14. Advantages of systematic in vitro transposon mutagenesis • Mutations can be stored and shipped as: • cosmid DNA • E coli containing cosmids • Streptomyces mutants • A Tn5062 insertion can be manipulated to: • change resistance marker (eg switch AprR to HygR ) • leave an in-frame deletion • induce transcription of downstream genes

  15. ME RBS gfp T4 T4 oriT ME stop apramycinR ME RBS gfp stop T4 Thyg T4 oriT ME hygromycinR ME RBS luxAB T4 oriT ME stop Thyg hygromycinR ME Tmmr tetR T4 oriT tcp Thyg ME hygromycinR Tn5062 Tn5066 Tn5069 Tn5070 • exchange cassettes can be excised as PvuII fragments and used to: • replace an existing Tn5062 insertion by Red recombination in E.coli • for de novo in vitro transposon mutagenesis

  16. Km Apr X X Apr Transfer of mutated cosmid to Streptomyces Transfer by conjugation from E.coli ET12567(pUZ8002) into S. coelicolor Select for marker replacement [AprRKanS] usually 1-10% of exconjugants if gene/operon is non-essential

  17. Insertional mutagenesis of cosmid SC7C7 6279200 bp 6290053 bp 1 2 3 4 x 5 6 7 SCO5750 osaA hybrid histidine kinase osaB response regulator Sph I Bam HI SCO5751 1 kb osaB complementing DNA

  18. 2) S. coelicolor R2YE MS + 250mM KCl MS A:wild type B:osaA (HK) mutant [insertion #1]; C:osaB (RR) mutant+vector; D:osaB (RR) mutant (complemented); E:osaB (RR) mutant [insertion #5] Mutant phenotypes 1) S. lividans A B R2YE (containing 10.3% sucrose) A: wild type B:osaB mutant [insertion x,Tn5493]

  19. 1 2 3 4 x 5 6 7 osaB response regulator osaA hybrid histidine kinase osaAB, genes involved in osmoadapation • osaB encodes a response regulator (insertion 5) that is essential for osmoadaptation during the transition between vegetative and reproductive growth • osaA mutants (1-4) all exhibit delayed aerial hyphal formation in the presence of osmolyte; a second orphan HHK (SCO7327) may also be involved in osmoadaptation • SCO5750 mutants (6) are unaffected by osmolyte; insertions 1-5 are non-polar with respect to SCO5750 • osaB complementation, with a fragment initially cloned linked to AprR of insertion 7, indicates osaA and osaB are independently transcribed • insertions 1 and 5 have been successfully introduced into S. lividans: similar phenotypes as for the S. coelicolor osaAB mutants were obtained

  20. Expression analysis of mutated gene Truncated protein eGFP Translation Translation Monitoring of gene expression Transcription promoter Chromo- some ME stop RBS gfp T4 apramycin resistance gene T4 oriT ME Tn5062

  21. osaB is induced by hyperosmolarity + sucrose - sucrose

  22. -35 -10 osaB has its own promoter t g c a 12 – 72h Timecourse of osaB expression: mRNA isolated from R2YE-grown cultures 6285056 chromosome position…… cttctggtctcccgccgcgcttccgctacgagcacagtgacatcacggtgacagggtgtg gcgacaggcggggtgcggctacgatgaccggcacaaggacgggcggcgcaagggagtcgt cccccggggcggcacccgccggtgccgtgccaagtcctgtggacaggggaggccccacgc cggggcgaggagggcgggccatggtgcagaaggccaagatcctcctggtcgatgaccggc cggagaatctgcttgcgctggaggcgatcctctcggcgctcgatcagacgctggtgcggg Transcription start Translation start

  23. Overproduction of ACT and RED in an osaB mutant • osaB mutant (+S)  wild-type (+S) osaB mutant (-S)  wild-type (-S)

  24. wild-type osaB mutant Complemented strain Overproduction of ACT and RED in an osaB mutant

  25. Osmoadaptation – conclusions • the response regulator encoded by osaB is essential for developmental osmoadaptation • osaB impacts on antibiotic production in conditions of hyperosmolarity • unlike most sensory kinase-response regulator gene pairs, osaB is independently transcribed • the sensory kinase encoded by osaA is required for osmoadaptation, but not essential – another kinase may also interact with OsaB

  26. (2) In vivo transposon mutagenesis Aim Generate a library of transposon induced, tagged mutants for gene function studies Kay Fowler

  27. Tn4560 (8 kb) Derived from Tn 4556 ofStreptomyces fradiae (Chung 1987) Viomycin phosphotransferasegene for selection in Streptomyces vph Recombinase ? ~Tn3 38 bpIRs 38 bpIRs

  28. Tn4560 delivery plasmid pKAY1 • based on temperature-sensitive plasmid pUC1169 (derivative of pIJ101 containing Tn4560) • pOJ260 (contains E. coli ori and oriT) was cloned at the unique BamHI site • encodes a truncated Rep protein due to mutation at the unique BstBI site: -GCCCCGTTCGCGAACTCCTCGGACGGATCGGGGACCTGA -AlaProPheAlaAsnSerSerAspGlySerGlyThr***

  29. Transposon delivery on pKAY1 introduced into Streptomyces by conjugation from E. coli 1. Mix Streptomyces and E. coli on agar plate2. Overlay with antibiotics: Nalidixic acid or carbenicillin to kill E. coliViomycinto select Streptomyces::Tn Conjugation plate 2d after overlay >1000 colonies contain independent Tn insertions

  30. In vivo transposon mutagenesis • wash off microcolonies • plate on SFM viomycin • harvest spores = Tn library • plate library using conditions to detect a specific phentype • isolate DNA from mutant • Ligation-mediated PCR

  31. Ligation Ligation-mediated PCR for target sequence amplification 1. Digest DNA using EagI (C’GGCCG) 2. Ligate non-phosphorylatedEnd primer/Adaptor 3. PCR End primer Genome Transposon Adaptor Tn primer No ligation End primer Tn primer PCR Product 3’ nested

  32. Target sequence identification • Use TA cloning to clone PCR products • Sequence inserts • Blast sequence against genome to identify target gene

  33. Bertolt Gust Tübingen (3) PCR targetting (Redirect)

  34. Acknowledgements Swansea: Amy Bishop osaAB Sue Fielding sequencing Paul Herron in vitro transposition Gareth Hughes Transposon Express Ricardo del Sol exchange cassettes Norwich: Govind Chandra ScoDB Tobias Kieser in vivo transposon mutagenesis Kay Fowler in vivo transposon mutagenesis

More Related