Fast and accurate Highly stringent and h ighly repeatable

1. Evaluation of the ExactID™ Method for Accurate and Rapid Typingof SNP and STR Loci From Sequencing Data Brian Young, Esley Heizer, Christine Baker, Angela Minard-Smith, Gokhan Yavas, Eric Keathley, A.J. Kuhlman, Rob Carnell Battelle, Columbus, OH REPORTING PERFORMANCE TESTING OVERVIEW ExactID is a simple and intuitive tool for fast and accurate analysis of next-generation sequencing (NGS) data. A STR Panels B SNP Panels Figure 1. Example Display of STR Alleles in the Kopiagram Format.(A) Five autosomal and one Y STR loci, where two loci are homozygous by size but heterozygous by sequence.(B) The same six loci displaying all responses above analytical threshold (AT) EXACTID FEATURES Figure 2. Sequence-Centric Genotype Report. • Fast and accurate • Highly stringent and highly repeatable • Backward compatible with STR allele sizing • Forward compatible with sequence-based typing • Proprietary non-alignment-based signal processing • Robust to all forensic marker types: STR, SNP, DIP • Robust to previously unknown STR allele sequences • Sequence-centric display of sequence-defined alleles Figure 5. Summary of STR Size Concordance Check. Specimens were sequenced using an Illumina MiSeq. Size-concordance was checked by comparison to fragment analysis. This work was performed in collaboration with NIST. A B Reviewable Data Summary and Provenance In .sefFile Analytical Thresholds Calculated From S/N Figure 6. Summary of SNP Concordance Testing.DNA was PCR amplified using published primer sets (Walsh et al. 2010). Sequencing was performed at Battelle on an Illumina MiSeq. Genotype concordance was checked by comparison to results generated by Identitas bead array. AT = 2(Maxnoise – Minnoise) Figure 7. Summary of Speed Testing.(A) Analysis time for a 24-plex SNP panel(B) Analysis times for a 24-plex STR panel. AT = noise + kσnoise Figure 4. SNP Alleles at Selected HIrisPlexLoci. Figure 3. Display of Heterozygote balance for SNPs. ACKNOWLEDGMENTS Thanks to Doug Storts and Promega Corporation for generously providing the STR amplification reagents; to Pete Vallone, Katherine Gettings and Kevin Kieslerof the Applied Genetics Group at NIST for DNA specimens and STR sequencing and CE concordance check; and to Laurence Rubin and Aruna Bansal at Identitas for SNP concordance data. Automatic Bracketing of STR Sequences TCTATCTGTCTGTCTGTCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA [TCTA][TCTG]3[TCTA]12