1 / 14

Genomic Ancestry Analysis in Wild Hybrid House Mice

Discover the genetics of speciation in the house mouse hybrid zone, examining subspecies M. m. domesticus and M. m. musculus. Explore parameter grid searches, simulate chromosome testing, and conduct simulations with this research. Learn how high-throughput computing can enhance biological sciences research and improve reproducibility.

hansen
Download Presentation

Genomic Ancestry Analysis in Wild Hybrid House Mice

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genomic Ancestry Analysis in Wild Hybrid House Mice Megan Frayer Ph.D. Student, Laboratory of Genetics UW-Madison HTCondor Week 2019

  2. Genetics of Speciation

  3. The house mouse hybrid zone can tell us about how speciation is proceeding between these subspecies M. m. domesticus M. m. musculus

  4. ATCGTCAGTCAGTCGATCGATACGTAGCATGCAGTACGATGCAGTACGATGATACG TAGCAGTCAGACACGTAGCTATGCATCGTACGTCATGCTACGTCATGCTACTATGC

  5. Parameter grid search 108,000 combinations of parameters to be tested

  6. Parameter grid search

  7. parameter_test.dag Examples of files to print: Submit files Executables Input for programs being run Scripts that will need to be run Create Input Files

  8. parameter_test.dag Create Input Files Parameter Test n Parameter Test 3 Parameter Test 2 Parameter Test 1 SUBDAG_EXTERNAL Compile results/create summaries Before HTC: 2 hours/test 24.6 years/108,000 tests With HTC: 2 hours/test 10 days/108,000 tests 24.6 years  10 days

  9. Testing with Simulated Chromosomes • How well is the program performing?

  10. Testing with Simulated Chromosomes

  11. inference_testing.dag Create Input Files Parameter Set 1 Set n Set 3 Set 2 Set 1 Parameter Set 2 Parameter Set n Parameter Set 3 Parameter Sets Set 1 Set 1 Set 1 Set 1 Inference Test Set 3 Inference Test Set n Inference Test Set 2 Inference Test Set 1 Compile results/create summaries Before HTC: 3 hours/test 6.25 days/50 tests With HTC: 3 hours/test 10 hours/50 tests 6.25 days  10 hours

  12. Simulations

  13. Variables Template Submit Files simulation.dag Replicate 3 Replicate n Replicate 2 Replicate 1 Before HTC: 2 hours/test 2.7 years/12,000 tests With HTC: 2 hours/test 30 hours/ 12,000 tests 2.7 years  30 hours Simulation.config DAGMAN_MAX_JOBS_IDLE = 1000

  14. Conclusion • HTC can improve research in biological sciences • Even simple DAGs can make a big impact on your research • DAGs can also improve reproducibility HTC has shortened my Ph.D. by 36.8 years.

More Related