1 / 17

PCR real time nel monitoraggio dell’infezione da BKV

PCR real time nel monitoraggio dell’infezione da BKV. V.Salotti e A.Azzi. BK virus nelle urine dopo ultracentrifugazione. La scoperta di BKV. Gardner SD, Field AM, Coleman DV, Hulme B. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1971.

haracha
Download Presentation

PCR real time nel monitoraggio dell’infezione da BKV

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PCR real time nel monitoraggio dell’infezione da BKV V.Salotti e A.Azzi

  2. BK virus nelle urinedopo ultracentrifugazione

  3. La scoperta di BKV Gardner SD, Field AM, Coleman DV, Hulme B. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1971

  4. Infezione da BKV Prima infanzia Via respiratoria Rene trapiantato • Infezione primaria • Latenza • Riattivazione rene linfociti cervello ….. Tratto urinario viruria

  5. Soggetti immunocompetenti Trapiantati di midollo Trapiantati renali AIDS asintomatica Cistite emorragica Stenosi ureterale Meningite, infezione disseminata ….. Infezione da BKV: eziopatologia • Interstitial nephropathy (PVAN) • Tumori ?

  6. Ricerca del DNA virale PCR qualitativa Nelle urine • Soggetti sani 17 % • gravidanza 15 % • Trapiantati di midollo 77 % • AIDS 40 % • Trapiantati rene [25 %] Nei linfociti • Soggetti sani 53 % • Trapiantati di midollo 57.5 % • AIDS 62.5 %

  7. Ricerca del DNA di BKV nel plasma /siero • La presenza di virus libero in circolo nei trapiantati di rene è considerata un indicatore di patologia renale BKV –associata. • Livelli significativi da definire

  8. Organizzazione del genoma dei polyomavirus

  9. PCR qualitativa per DNA di BKV

  10. PCR quantitativa competitiva per BKV • L’estrazione dei campioni • La sintesi del competitore • La calibrazione del competitore • La reazione • La rivelazione

  11. Sintesi del competitore • Mutagenesi sito-specifica/hot start PCR • NcoII: 5’TATTTTGCCATGGAGATATG 3’ • NcoI: 5’CATATCTCCATGGCAAAATA 3’ • Enzima NcoI • ccatgg • ggtacc

  12. PEP 1 Nco II TA target sequence Nco I PEP 2 Mutagenesis obtained with the primer Nco II GC GC Mutagenesis obtained with the primer Nco I Denaturation and Rinaturation 5’ 5’ 3’ 3’ Extension with the primers PEP 5’ 5’ standard Fig.. 1 PCR site-directed mutagenesis.

  13. Mix + Taq gold • 5 l estratto campione urina • 40 fg – 200 fg – 1 pg – 5 pg – 25 pg competitore

  14. PCR quantitativa competitiva per DNA di BKV:la rivelazione

  15. Quantificazione dei prodotti della PCR • Software Molecular Analyst (Bio-Rad) • y • . Y= OD banda comp x 1.88 • OD banda campione . • . • . • x • log[conc competitore] • calcoloretta di regressione e coefficiente di regressione lineare

  16. Trapiantati di midollo Cistite emorragica Carica virale nelle urine PCR quantitativa competitiva

  17. PCR quantitativa competitiva per BKV • Limiti • Tempi • Costi • Manualità • Sensibilità • riproducibilità

More Related