1 / 37

Genetics of Cancer

Genetics of Cancer. Part 2 - January 23, 2007. Review. Two mutations must occur:. Review. Two mutations must occur: Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division. Review. Two mutations must occur:

hue
Download Presentation

Genetics of Cancer

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genetics of Cancer Part 2 - January 23, 2007

  2. Review • Two mutations must occur:

  3. Review • Two mutations must occur: • Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division

  4. Review • Two mutations must occur: • Protooncogene stuck in the “on” position (gas pedal down), constantly stimulating cell division • Tumor Suppressor Gene inactivated (brakes disconnected from accelerating car)

  5. What else must happen? • External controls overcome • Cells not limited by: • Crowding • Lack of attachment • Lack of nutrients • (remember “angiogenesis”?)

  6. What else must happen? • Telomerase must be present to create cellular immortality.

  7. What else must happen? • Telomerase must be present to create cellular immortality. • Most human cells divide 50-100 times before entering G0 permanently or committing cell suicide (apoptosis)

  8. Telomerase • OK, but…how does a cell know it has divided 50-100 times???

  9. Telomerase • OK, but…how does a cell know it has divided 50-100 times??? • Tips of chromosomes are capped with a sequence of bases (TTAGGG) repeated 1000’s of times. • Each division removes 50-200 of these bases

  10. Telomerase, con’t • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG

  11. Shortening… • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG

  12. Shortening, until… • TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG TTAGGGTTAGGGTTAGGGTTAGGG

  13. Shortening, until… • TTAGGGTTAGGGTTAGGG • It can’t divide any longer!

  14. Stem Cells • Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly - must keep dividing!

  15. Stem Cells • Stem cells produce cells (sex cells, blood, hair) that need to be replaced regularly - must keep dividing! • Telomerase is an enzyme that rebuilds the telomeres (adds TTAGGG) • If telomeres don’t get shorter, cells don’t get older

  16. Back to cancer cells… • Cancer cells have a mutation that allows the production of telomerase. • Leads to cells being immortal that should die out. • Telomerase = gas tank!

  17. Metastasis must spread cancerous cells • Cells spread via the circulatory or lymphatic system • 99% of cancer cells die en route, but some lodge in capillaries or lymph nodes • Cancer cells can break down material between cells to travel within tissues, leading to new colonies

  18. Cancer and inheritance • Two-hit hypothesis: TSG’s are inherited in pairs and both copies must be mutated

  19. Cancer and inheritance • Inherited one mutant TSG? You’re prone to developing cancer early in life (middle age or earlier) • Two good TSG’s? Cancer may come later in life, if at all.

  20. Cancer and inheritance • Inheritance is only a small part of developing cancer (colon cancers are inherited 15% of the time, breast 7%) • Environmental factors often more important determinant

  21. p53 • “THE GUARDIAN OF THE GENOME”

  22. p53 • “THE GUARDIAN OF THE GENOME” • Your primary TSG • Mutated in 55% of all cancers

  23. p53 • Activated when DNA damage is bad • 1st - Halts cell cycle

  24. p53 • Activated when DNA damage is bad • 1st - Halts cell cycle • 2nd - Starts DNA repair and restarts cell cycle if successful

  25. p53 • Activated when DNA damage is bad • 1st - Halts cell cycle • 2nd - Starts DNA repair and restarts cell cycle if successful • 3rd - Causes apoptosis (cell suicide) if repair unsuccessful

  26. Review • Gas pedal =

  27. Review • Gas pedal = protooncogene

  28. Review • Gas pedal = protooncogene • Brake =

  29. Review • Gas pedal = protooncogene • Brake = tumor suppressor gene

  30. Review • Gas pedal = protooncogene • Brake = tumor suppressor gene • Gas tank =

  31. Review • Gas pedal = protooncogene • Brake = tumor suppressor gene • Gas tank = Telomerase (adds telomeres TTAGGG)

  32. Review • Two-hit hypothesis?

  33. Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated

  34. Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell?

  35. Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell = p53

  36. Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell = p53 • Cell suicide?

  37. Review • Two-hit hypothesis = BOTH copies of a TSG must be mutated • Guardian of the cell = p53 • Cell suicide = apoptosis

More Related