1 / 29

Proteins and Base Mutations

Proteins and Base Mutations. Polypeptides made up of amino acids Peptides are at Least 2 amino acids bonded together via peptide bonds Proteins ARE polypeptides, numerous amino acids.

iona
Download Presentation

Proteins and Base Mutations

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Proteins and Base Mutations

  2. Polypeptides made up of amino acids • Peptides are at Least 2 amino acids bonded together via peptide bonds • Proteins ARE polypeptides, numerous amino acids **All AA’s look the same EXCEPT the “R” group. It’s a group of molecules. They determine which amino acid it is because each are different! **Peptide Bond between amino acids First Recall Proteins------

  3. The amino acid sequence determines the protein!! • Shape-specific • Example - The sequence for a specific enzyme will be totally different from that of a hormone! Human Growth Hormone Amylase Enzyme Amino Acid Sequence - Polypeptide

  4. Basic Types of Proteins

  5. Structural Proteins – forms part of cell materials • fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin • Collagen, and elastin. Collagens and elastin provide support for connective tissue such as tendons and ligaments. Structural Proteins

  6. Hormones – Body’s chemical messengers Functional Proteins

  7. Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism • Growth and development • Metabolism - how your body gets energy from the foods you eat • Sexual function • Reproduction • Mood • Enzymes – catalyze chemical reactions. • Example – Amylase is the enzyme that breaks starches in your mouth. Speeds up the rate of digestion. Functional Proteins

  8. Remember that DNA is replicated during the S phase of Interphase in both Mitosis and Meiosis (the formation of gametes) • Mutations may or may not change the function of a protein • May change phenotype, how a gene is expressed • Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype Mistakes Can Occur

  9. ***Errors in replication, transcription, cell division, or by external agents called mutagens (chemicals, radiation, X-rays etc.) ***Some occur randomly, some phenotypes are selected for in nature ***Although mutations can cause problems, if it weren’t for mutations we wouldn’t have new genes such as those for green eyes Mutations-------

  10. ** Newly synthesized DNA is EXACTLY the same as the parent DNA……or is it??

  11. Enzymes proofread as bases are paired during replication and replace those wrongly paired • Other enzymes police the replication process • But………… “Fixing” Errors

  12. May be random or spontaneous (influenced) • When genes have an error in their DNA code, they may not work properly, and are said to be "altered" or mutated. • DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection • Mistakes that occur when a cell copies its DNA in preparation for cell division. • Can occur during meiosis (making of sper, and egg) Mutations

  13. Enzymes • Speed up the rate of reaction • For example, amylase breaks down starches in your mouth Functional Proteins

  14. Mismatched Base Pair Can Occur – Usually Random

  15. Spontaneous Mutions Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur

  16. Some mutated cells will be defeated by the body's immune system • others will undergo apoptosis, or cell suicide. • occasionally a cell with mutations slips through proofreading safeguards. • When mutations accumulate, the genetic material is so scrambled that the cell no longer acts like a normal, healthy cell. • Tumors, mass of cells that have no purpose, may form Mutated Cells

  17. Not malignant tumor (cancerous) • Does not invade nearby tissue or spread to other parts of the body the way cancer can. • But benign tumors can be serious if they press on vital structures such as blood vessels or nerves. • Some, such as colon polyps, can become cancerous Benign Tumors (non-cancerous)

  18. Abnormal cells grow uncontrolled • Invades surrounding tissues • Usually capable of producing metastases (spread to other organs) • May recur after attempted removal • May cause death of the host unless adequately treated Cancerous Tumor

  19. **Mutations can occur during meiosis, the making of sperm or egg by changing the nucleotide sequences within a gene and can be passed along to offspring **Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm formation **The mutation may produce a new trait (good OR bad) or it may result in a protein that does not work correctly. Mutations and Reproduction

  20. ** Point mutations, base substitution, affects a single base **Frameshift – Addition or deletion of a base – Affects entire protein **chromosomal mutations – affects whole chromosomes Types of Mutations

  21. Base Pair Substitution – AKA Point Mutation

  22. Affects a single base and change the codon • May or may not affect the amino acid • Sometimes if the third base of the codon changes, the amino acid may stay the same! • UCU • UCC • UCA • UCG ALL code for Ser Point Mutations

  23. TACCAGGATTAACATGGAAGTGTAATC DNA AUGGUCCUAAUUGUACCUUCACAUUAG mRNA Met Met Val Val Leu Leu Ile Ile Val Pro Pro Ser Ser His His (STOP) (STOP) AminoAcid) Leu NORMAL SEQUENCE What if the C was substituted with an A ????? TACCAGGATTAA AATGGAAGTGTAATC DNA AUGGUCCUAAUU UUACCUUCACAUUAG mRNA

  24. Addition or deletion of a base shifts the amino acids left or right affecting the whole protein. It won’t function properly Frameshift Mutation

  25. Met Met Val Val Tyr Leu Leu Ile Ile Val Pro Leu Ser Ile His His (STOP) Ser or Arg…. Frame-Shift Mutations (Add or Delete a Base) TACCAGGATTAACATGGAAGTGTAATC AUGGUCCUAAUUGUACCUUCACAUUAG TACCAGGATTAA ATGGAAGTGTAATC… AUG GUC CUA AUU UACCUUCACAUUAG… Example: Deletion of the C shifts the entire protein over to the left – Framshifts change ENTIRE PROTEIN – There is NO STOP CODON!!

  26. Sickle Cell Anemeia – red blood cells are misshaped (sickle-shaped) and cannot carry enough oxygen Base Substitution Example

  27. Tay-Sachs - disorder of the central nervous system. • An enzyme that is responsible for breaking down certain fatty substances in brain and nerve cells is ineffective and these substances accumulate, eventually destroying brain and nerve cells, and so the entire central nervous system. • It is an inherited trait and you can be a carrier Example of Frameshift

  28. Mutation Exercise

  29. To give you a better idea of genetic mutations that effect proteins (we haven’t gotten to wntirechromsomes yet) do a little research… • Research a trait, disease/disorder that is caused by a point mutation and one that is caused by a frameshift mutation. Without getting to technical, describe where the mutation occurs, the symptoms and the prognosis Your turn……..

More Related