1 / 48

Major Components of a Gene

Major Components of a Gene. Promoter: The DNA region that signal initiation of transcription 5’-Untranslated Region: A short DNA sequence rich in GC pairs present in the 5’-flanking region of the gene Exon : Segment of a gene which is decoded to give an mRNA product or a mature mRNA product.

ivria
Download Presentation

Major Components of a Gene

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Major Components of a Gene • Promoter:The DNA region that signal initiation of transcription • 5’-Untranslated Region:A short DNA sequence rich in GC pairs present in the 5’-flanking region of the gene • Exon:Segment of a gene which is decoded to give an mRNA product or a mature mRNA product

  2. Major Components of a Gene • Intron:Noncoding DNA which separates neighboring exons in a gene • 3’-Untranslated Region:A short DNA sequence in the 3’-flanking region of the gene that contains polyadenylation signal • Codon:A nucleotide triplet which specifies an amino acid or a signal for terminating the synthesis of a polypeptide

  3. The Genetic Code • Three-nucleotide sequences (codons) control selection of amino acids for protein synthesis • Four kinds of Nucleic acids in mRNA: Adenine, Guanine, Uracil, Cytosine • Commaless and nonoverlapping within a reading frame

  4. The Genetic Code • Non-ambiguous (no codon is specific for two different products) • Redundant (or Degenerate) • Code degeneracy usually in the third position of the codon

  5. Major Components of a Gene • Open reading frame (ORF): A long sequence of DNA in which there are no termination codons • Example: 5’…TGTCCCGGCATGGATATCCGGAACAACCTCACTAGG…3' …CysProGlyMetAspIleArgAsnAsnLeuThrArg…

  6. Gene Transcription • 5’-Capping • 3’-Polyadenylation • Intron Splicing

  7. Basic Concepts in Gene Mapping • genomic DNA:the entire complement of genetic material • mRNA:RNA that is transcribed from the genomic DNA of a gene • cDNA:DNA which is synthesized by the enzyme reverse transcriptase using mRNA as a template

  8. Genomic DNA Transcription mRNA Reverse Transcription cDNA Basic Concepts in Gene Mapping

  9. Basic Concepts in Gene Mapping Genomic DNA Transcription Pre-mRNA Splicing Mature mRNA Reverse Transcription cDNA

  10. Basic Concepts in Modern Genetic Epidemiology • Allele:Alternative forms of a gene or DNA sequence at a specific chromosomal location • Allelic association:Any significant association between specific alleles at two or more neighboring loci • Allelic heterogeneity:Different mutations at the same locus cause the same phenotype

  11. Basic Concepts in Modern Genetic Epidemiology • Locus:The physical location of a gene • Locus heterogeneity:A phenotype may be caused by mutations at more than one gene locus

  12. Basic Concepts in Modern Genetic Epidemiology • Mutation: A change in the DNA • Polymorphism: A locus with more than one allele, each of which occurs with at least 1% frequency

  13. Point Mutations • Base substitutions • Change in a single nucleotide • Transitions: changes from purine-purine or pyrimidine-pyrimidine. • Examples: AG, TC • Transversions: changes from purine to pyrimidine or vice versa. • Examples: AT, GC

  14. Point Mutations • Synonymous substitutions:A substitution which replaces one codon by another without changing the amino acid that is specified =silent mutation • Non-synonymous substitutions: A substitution which replaces one codon by another with changing the amino acid that is specified =missense mutation

  15. Mutations • Deletions - small and large • Example: insulin receptor gene • TTCAAGAGATgATTCAGATGG (small) • Entire gene (large)

  16. Mutations • Insertions • Example: ACE Gene • Intron 16 D/I (289-bp Alu-I repeat sequence) • Inversions • Example: IDS Gene • Inversions of Exons 8 and 9

  17. Point Mutations • Missense mutation: A codon change can occur, such that a new amino acid is coded for. • Nonsense mutation: A stop codon can be created, causing termination of synthesis. • Silent mutation: If no change in product is observed, because of the redundancy of the genetic code. • Frameshift Mutation: Change in reading frame, usually by deletion or insertion of one or more nucleotides.

  18. Point Mutations • Splicing mutation: Changes in the splice donor/acceptor site or branch site that cause aberrant splicing • Example: Insulin receptor gene • Intron4 AG  GG (splice acceptor site) • Regulatory mutation: Changes in promoter site sequences that can affect the rate of transcription • Example: IL1 alpha gene • GGCAACA(CT)CATTGAAGGC (-889 relative to the transcription initiation site)

  19. Mitosis and Meiosis • Mitosis: A type of nuclear division that results in two daughter cells identical to the original cell • Meiosis: The process of two successive nuclear divisions resulting in cell with 1/2 the genetic complement of the original cell

  20. Hardy-Weinberg Equilibrium • Hardy and Weinberg discovered that for a given population, under certain stable conditions, gene frequencies tended to remain constant

  21. Hardy-Weinberg Equilibrium • Let p = freq. Of one allele (A) • Let q = freq. Of the alternative allele (a) • p +q =1 • HWE predicts that proportion in the next generation will be: • p2 + 2pq + q2 =1, where • p2, 2pq, q2 represent allele freq. of AA, Aa, and aa

  22. Hardy-Weinberg Assumptions • Population is definitely large • Each genotype is equally likely to mate with any other • All genotypes produce viable offspring with same frequency - have equal genetic fitness • No mutation occurs • No migration in or out of population occurs

  23. Mendel’s First Law • The law of segregation • During gamete formation each member of the allelic pair separates from the other member to form the genetic constitution of the gamete

  24. Mendel’s Second Law • The law of independent assortment • During gamete formation the segregation of the alleles of one allelic pair is independent of the segregation of the alleles of another allelic pair

  25. Basic Concepts in Modern Genetic Epidemiology

  26. Autosomal Dominant Inheritance

  27. X-Linked Inheritance

  28. Autosomal Recessive Inheritance

  29. Basic Concepts in Gene Mapping • Genetic Linkage Map: Measures the amount of recombination between two loci; quantified by either recombination fraction or centiMorgans • Physical Map: Quantifies the actual amount of DNA, usually in base pairs, between two loci

  30. Genetic Map (Distribution of Cross-Overs) A C A B B D C D Physical Map (Number of DNA Base Pairs) A-B: Suppression of recombination Genetic Distance Shorter than Physical Distance B-C: Increase of recombination Genetic Distance Larger than Physical Distance Genetic Map and Physical Map

  31. Basic Concepts in Gene Mapping • Sequence-tagged site (STS): any piece of DNA whose sequence is known and for which a specific PCR assay has been designed • Example: • 273-bp STS (Genebank: G54567) • TGACTCCAATGACCGTCTGTCTATTTCACTGTATCCAGGCCAGTCTCTTTGAAGCTCTTTAAAAACATAATCCTTTAAGGTATATGAGAGGTCCTTAGAATTCAGATTGGCTACCTAGTATGAGGTATAAAAACAGAGCATTAGGTATTTTTACTATCATCTCCTAACCTAAAACAGGCAACCTTTAGGATTTACACTGAAAATAATTACATCAATTGGCCCCAAAGGGACTGCTAGTTTTGTATTATATGCCAGATCTCAATAAATGCCATT

  32. Basic Concepts in Gene Mapping • Expressed sequence tag (EST): A short sequence of a cDNA clone for which a PCR assay is available • Example: 187-bp cDNA (Genebank: AL110360) • AAAAAAGGCAGCAGCTACCAAGAAACCAGCCCCTGAAAAGAAGCCTGCAGAGAAGAAACCTACTACAGAGGAGAAGAAGCCTGCTGCATAAACTCTTAAATTTGATTATTCCATAAAGGTCAAATCATTTTGGACAGCTTCTTTTGAATAAAGACCTGATTATACAGGCAAAAAAAAAAAAAAAAAA

  33. Basic Concepts in Gene Mapping • Recombination:The process during meiosis by which homologous chromosomes exchange material • Crossover:The physical process that results in the exchange of genetic materials between two paired chromosomes during a recombination event • Recombination fraction:The frequency of crossing over between two loci

  34. Crossover

  35. Basic Concepts in Gene Mapping • Marker:A polymorphic DNA or protein sequence derived from a single chromosomal location • Primer:A short nucleic acid sequence which specifically binds to a single strand of a targeted nucleic acid sequence

  36. Basic Concepts in Modern Genetic Epidemiology • Genotype: The observed alleles at a locus in an individual • Haplotype: A series of alleles found at linked loci on a single chromosome

  37. Basic Concepts in Gene Mapping • Heterozygous:The alleles at a genetic locus are different from one another • Example: Aa • Homozygous:The alleles at a genetic locus are identical • Examples: AA and aa

  38. Basic Concepts in Gene Mapping • Single nucleotide polymorphism (SNP): a substitution, deletion, or insertion of a single nucleotide • Examples: AG, AC • cSNP: A SNP that occurs in the coding sequence of a gene • Example: CTC (Leu)TTC (Phe)

  39. Basic Concepts in Gene Mapping • Microsatellite DNA: small array of tandem repeats of a very simple sequence, often between 1-4 bp (often < 0.1 kb) Example: A tetranucleotide repeat microsatellite …GAAAGAAAGAAAGAAAGAAAGAAAGAAA... • Minisatellite DNA: An intermediate size array of short tandemly repeated DNA sequences Example: A minisatellite (Genebank: AF157691) …(AGGGGGTGAGGGTGGGTGTGCTGG)n...

  40. Basic Concepts in Modern Genetic Epidemiology • Polymorphism Information Content:A measure of marker informativeness that reflects the fraction of matings in which a particular parent is expected to be fully informative • Heterozygosity:The fraction of individuals that are likely to be heterozygous at that locus

  41. Basic Concepts in Gene Mapping • Identity by descent (IBD):Two alleles are IBD which it can be determined with certainty that they have been inherited from a common ancestor • Identity by state (IBS):Two alleles are IBS when they share the same state

  42. AB CD AC AC IBD sharing: 2 IBS sharing: 2 IBD and IBS AB AC AB AC IBD sharing: 0 IBS sharing: 1

  43. Basic Concepts in Gene Mapping • Linkage: The tendency of genes or other DNA sequences at specific loci to be inherited together as a consequence of their physical proximity on a single chromosome • Linkage Disequilibrium: Nonrandom associations of alleles at linked loci

  44. LOD Score • a two-point LOD score defined by Morton (1955) • L(pedigree|=x): the likelihood of observing a particular configuration of a disease and a marker locus in a family assuming a selected range of  (00.5)

  45. Basic Concepts in Modern Genetic Epidemiology • Morgan:A unit of genetic distance corresponding to a length of DNA which, on average, undergoes one crossover per individual chromatid strand • centiMorgan (cM):A unit of genetic distance equivalent to a 1% probability of recombination during meiosis

  46. Aa Bb Aa Bb Aa Bb aa bb aa bb aa bb Basic Concepts in Modern Genetic Epidemiology Phase Unknown Phase Known

  47. Basic Concepts in Gene Mapping • Penetrance: The probability of expressing a phenotype given a genotype • Phenocopy: A trait that appears to be identical to a genetic trait but is caused by non-genetic factors • Pleiotropy: One gene loading to many different phenotypic expressions.

  48. Basic Concepts in Gene Mapping • Bacterial artificial chromosomes (BAC): A recombinant plasmid which permits propagation of very large inserts (up to 300kb) in bacterial cells • Yeast artificial chromosomes (YAC): An artificial chromosome produced by combining large fragments of foreign DNA with small sequence elements necessary for chromosome function in yeast cells

More Related