Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH

1. Using Phylogenetic Analysis to Identify HIV Transmission Channels among Persons Newly Diagnosed with HIV-1 Infection in Los Angeles County, 2009-2010 Kwa Sey, PhD, MPH Yingbo Ma, MS Nannie Song, MPH

2. BACKGROUND • Los Angeles County ranks second in nation only to New York City for highest number of living AIDS cases • Between 1982-2010, cumulative total of 75,114 persons with HIV/AIDS reported in LAC • Major transmission channels indicated by self-report: • male to male sex (79%) • heterosexual sex (12%) • injection drug use (9%) *2010 Annual HIV Surveillance Report, January 2011:1-32, HIV Epidemiology Program., LAC-DPH

3. BACKGROUND • New techniques, such as phylogenetic analysis of HIV sequence data, can provide biological evidence for HIV transmission channels and signal emerging trends

4. What is Phylogenetic analysis? • The means of inferring evolutionary relationships through molecular sequencing data. The evolutionary history is usually depicted as a branching, treelike diagram

5. What is Phylogenetic analysis? • Phylogenetic relationships used to infer epidemiological links among individuals, such as persons infected with HIV • Phylogenetic analysis used to understand patterns of HIV transmission among young black MSM in Mississippi. • (CDC, 2011)

6. HIV Sequencing/Genotyping Schematic of HIV-1 particle (in cross-section) Viral genome HIV GENOTYPING RESULT ACTCTTTGGCAACGACCCCTTGTCACAATAAAGATAGGGGGGCAACAAAAGGAAGCTCTATTAG… Fragment of the pol region for VARHS genotyping: 1020 nucleotides

7. Guidelines for genotyping • Genotyping now recommended for all newly diagnosed HIV infected individuals, presenting us with increasingly comprehensive HIV sequence data and opportunity to investigate population level HIV transmission patterns

8. OBJECTIVES • Objective of this analysis to use phylogenetic analyses to characterize HIV transmission channels in Los Angeles County

9. METHODS • Obtained HIV genomic sequences from VARHS (Variant Atypical and Resistant HIV Surveillance System) • VARHS • extension of the existing national population-based HIV/AIDS case surveillance system • coordinated and funded by CDC • Since 2006, as part of VARHS, the LAC DHSP HIV Epidemiology has obtained HIV pol region genetic sequences from county residents newly diagnosed with HIV

10. METHODS For inclusion in this analysis, cases had to be: • LAC residents • Newly diagnosed with HIV • Reported to eHARS following a confidential HIV test • Antiretroviral naïve • Have available genomic sequence (pol region) data from specimen collected within 3 months of diagnosis • .

11. METHODS • Obtained genetic sequencing data for 1,407 (29%) out of 4933 LAC HIV cases diagnosed between 2009 and 2010 • HIV sequence data merged with demographic and risk behavior data from the Enhanced HIV/AIDS Reporting System (eHARS)

12. METHODS • Neighbor joining phylogenetic analysis performed on pol sequence spanning protease and reverse transcriptase • Nucleotide distances calculated using Kimura's two-parameter method in MEGA5, with 1000 bootstrap replications • Transmission clusters defined as sequences that had: • common node of bootstrap values greater than 95% and • average genetic distance lower than 0.015 nucleotide substitutions per site

13. RESULTS

14. Gender

15. Age at HIV diagnosis Average age: 33 years.

16. Race/Ethnicity

17. Country of Origin

18. MSM Cluster- 56% MSM/IDU Cluster- 6% MSM/HET Cluster- 6% IDU/HET Cluster- 6% Identified 16 clusters, representing 49 cases. Each cluster comprised of 3-4 cases. Clusters categorized into 4 cluster types. All subtype B.

19. MSM,19yrs, White, USA-born 100 MSM, 21yrs, White, USA-born 98 MSM, 25yrs, Latino/Hispanic, USA-born 99 MSM, 20yrs, Black/African American, USA-born 0.005 “MSM” Transmission Channel • This cluster of 4 represents the “MSM” Transmission Channel.

20. Characteristics of MSM clusters

21. MSM, 48yrs, White, Unknown origin, K103N 99 100 MSM, 41yrs, White, USA-born, K103N Male IDU, 31yrs,Black/African American, USA-born 0.005 “MSM/IDU” Transmission Channel • This cluster of 3 represents “MSM/IDU” Transmission Channel.

22. Male Child, 2, Latino/Hispanic, USA-born Female IDU,18, Latino/Hispanic, USA-born 100 Female HET, 39, Latino/Hispanic, USA-born 99 0.005 “IDU/HET Female” Transmission Channel • This cluster of 3 represents IDU/HET female transmission channel.

23. Female HET,19, Latino/Hispanic, Mexico-born 100 Female HET , 35, Latino/Hispanic, USA-born 99 MSM, 56, Latino/Hispanic, Mexico-born 0.005 “MSM/HET” Transmission Channel • This cluster of 3 represents MSM/HET transmission channel.

24. DISCUSSION • The results provide biological evidence for the major HIV transmission channels that have previously been established by traditional epidemiological data. • Small sample size limits the inferences that may be made based on this data.

25. CONCLUSIONS • Phylogenetic analysis has potential to serve as additional source of information to validate descriptions of local HIV epidemics inferred from self-reported behavioral data and case studies

26. No conflict of interest to disclose.

27. CONTACT INFORMATION KwaSey PhD, MPH 600 S. Commonwealth Ave. Suite 1920 Los Angeles,CA90005 esey@ph.lacounty.gov

29. MSM Only Cluster- 75% MSM/IDU Cluster- 13% IDU/HET Cluster- 3% MSM/HET Cluster- 6% Other/Unknown Cluster- 3% 85% Boot strap Value Cutoff: 32 clusters, representing 110 cases, were identified. Each of these clusters comprised of 3-6 cases. The clusters were categorized into 5 cluster types. All were subtype B.