1 / 23

Tracking the genetic legacy of past human populations through the grid

Tracking the genetic legacy of past human populations through the grid. Nicolas Ray University of Geneva & UNEP/GRID-Europe. Swiss Grid Day, Bern, November 26 th 2009. Adapted from Cavalli-Sforza & Feldman, 2003. Human migrations. [12,000]. [55,000]. Homo sapiens sapiens.

kalona
Download Presentation

Tracking the genetic legacy of past human populations through the grid

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Tracking the genetic legacy of past human populationsthrough the grid Nicolas Ray University of Geneva & UNEP/GRID-Europe Swiss Grid Day, Bern, November 26th 2009

  2. Adapted from Cavalli-Sforza & Feldman, 2003 Human migrations [12,000] [55,000] Homo sapiens sapiens

  3. Why aiming at a good demographic model • 1. Better understand human evolution • Origin of modern human (when, where, how many?) • Relationship with other members of the Homo genus • 2. Distinguish between the effect of demography and those of selection (biomedical applications)

  4. Observed patterns of genetic diversity in contemporary populations A complex past demography fluctuation in effective pop. size substructure migrations Gene-specific factors mutations recombination selection

  5. Adapted from Cavalli-Sforza & Feldman, 2003 A complex demography [10,000] demographic and spatial expansions [55,000] population bottlenecks secondary contacts population isolation fast migration events

  6. SPLATCHE SPatiaLAnd Temporal Coalescences in Heterogeneous Environment (http://cmpg.unibe.ch/software/splatche)

  7. Carrying capacity low high From environment to demography Spatial resolution: 100 km

  8. From environment to demography Friction low high

  9. Cell or deme Pop. size time Demographic simulations stepping-stone model (cellular automata)

  10. Demography and spatial expansion Population density

  11. Genetic simulations

  12. Summary statistics • Within population: • S, p • Between populations • Pairwise FST • Global FST • Globally • S, p ACCTAGTACAATCGGTAATGCCATTGGT Modèle de mutation Mutation Simulated genealogy TCCTTGTA…ATTGGT ACCGAGTA…GTTGGT

  13. ApproximateBayesian Computations (ABC) Computational issues Computer clusters 1-10 mio. UBELIX (>500 nodes) Zooblythii (~40 nodes)

  14. Computational issues A fully spatially-explicit model using 500 loci in 800 individuals:  10 CPU-years Adding long-distance dispersal:  20 CPU-years

  15. SPLATCHE on the grid • early 2005: joined the Biomed VO of the EGEE project • mid 2005: tested on GILDA test bed, and deployed on the Grid • since mid 2006: production mode and optimization

  16. GRID Statistical tools Posterior distribution of demographic/genetic parameters of interest Use of SPLATCHE on the grid N simulations • Independent simulations: • the more CPUs, the better • job failures are not that bad

  17. Submission time multi-threaded application using up to 30 RBs (used for the WISDOM project) Fetching time of job outputs in-house multi-threaded solution for checking status and getting outputs GRID Optimizations Reduction of the number of simulations (Daniel Wegmann) By MCMC. Promising results (~50 times less sims) 5 mio. simulations

  18. Geographic origin of human dispersal Ray et al. (2005) Genome Research

  19. Interactions among populations Interaction between modern humans and Neanderthals in Europe Currat & Excoffier(2004), PLoS Biol.

  20. Cane toad invasion in Australia Estoup, A., Baird, S. J. E., Ray, N., Currat, M., Cornuet, J.-M., Santos, F., Beaumont, M. A. and L. Excoffier. Combining genetic, historical and geographic data to reconstruct the dynamics of the bioinvasion of cane toad Bufo marinus. Submitted

  21. Take-home message

  22. Thankyou!

More Related