1 / 40

A couple notes

A couple notes. Lab 4: Transcription and Translation. Where are we today?. To here. Today we’ll go from here. Text. Transcription: Translation:. Transcription: writing again Translation:. Transcription: writing again Translation: changing languages. Off to see the wizard.

kanoa
Download Presentation

A couple notes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A couple notes

  2. Lab 4: Transcription and Translation

  3. Where are we today?

  4. To here Today we’ll go from here... Text

  5. Transcription: • Translation:

  6. Transcription: writing again • Translation:

  7. Transcription: writing again • Translation: changing languages

  8. Off to see the wizard... Sending ‘messages’ out from DNA • DNA replication • both strands => new DNA • => new cell • Transcription • 1 strand => new RNA • => new protein

  9. Amino Acids • You & partner have an amino acid; which is it? (homepage => quick refs -> amino acids)

  10. Amino Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • How many are there? • Possible?

  11. Nucleic Acids • How are they similar? • How are they different? • What do the differences mean in terms of “feel”? • Which is more diverse in terms of shape and ‘feel’? • Which would allow for more diverse shapes and surfaces when ‘connected’?

  12. A little Vocab • DNA • mRNA • rRNA • tRNA • Codon • Anticodon

  13. How does a codon ‘mean’ an amino acid?

  14. Translation • Short video • http://www.youtube.com/watch?v=5bLEDd-PSTQ

  15. The Play is the thing…

  16. The Play is the thing… Or, Fun With Blocks

  17. The Play is the thing… • ‘Types of Bonds’ • Velcro – can be easily broken/re-made during lab • Duct tape – breaking it gets you a zero (0) for this week’s quiz

  18. The Play is the thing… • The Players

  19. The Play is the thing… • The Players • tRNA

  20. The Play is the thing… • The Players • tRNA • Ribosome

  21. The Play is the thing… • The Players • tRNA • Ribosome • Aminoacyl tRNA synthetase

  22. The Play is the thing… • The Players • tRNA • Ribosome • Aminoacyl tRNA synthetase • RNA polymerase

  23. The Play is the thing… • The Players • tRNA (4 people) • Ribosome (1) • Aminoacyl tRNA synthetase (4) • RNA polymerase (1-2) * and RNA • Termination factor (1) Numbers are per molecule for 2 molecules going at once

  24. Learning your ‘lines’ • Handout: In pairs, answer questions related to your task • Lab manual, textbook, internet OK as sources • Meet your blocks-- 5’ is the end that sticks to hair, socks, shirts 5’ end is pointy/spiky 3’ end is soft/furry

  25. DNA Template • 5’ CTTAAATCCGAATGCCCATG 3’ 5’ is “sticky”, 3’ is “fuzzy”

  26. 5’ CTTAAATCCGAATGCCCATG 3’ 5’ is “sticky”, 3’ is “fuzzy”

  27. Wielding the Power • ‘Recall’ that ribosome assembly is the result of methionine tRNA finding a match on mRNA in presence of small ribosome subunit • Only methionine tRNA (it will ‘know itself’ once crowned by the synthetase that hands out met) can team with small ribosomal subunit & join with the ‘AUG’!

  28. Walk-through with 1 tRNA • Everybody watches visits to synthetase, ribosome • In reality, how is everyone finding each other? • In the real world, everything is happening all the time; all is happenstance

  29. Ready? • mRNA at the central bench • ribosome assembles around it • synthetases at bench corners (or ‘diffuse’ opp. direction vs. tRNA) • tRNAs will ‘diffuse’ by following a path through the room • When any event first happens*, action stops, molecules involved will announce, explain • Go until a protein happens Includes ‘didn’t work’

  30. “Who” knows what’s going on? • What happens if a tRNA carries the wrong amino acid? • What happens if the mRNA contains a copy error relative to DNA? • What happens if a tRNA has a mutated anticodon

  31. Meet your new best friends

  32. Protocol • ½ inch layer of milk onto plate • 1 drop of each food coloring onto various locations around perimeter • Dab wooden stick with detergent • Touch stick to center of milk • Observe! • Hypothesize! • Open rubric

  33. Power Balance

  34. Background • I want to talk to you briefly about a product. • According to a number of testimonials, it can... • improve your balance • improve your athletic performance

  35. Says who? SHAQUILLE O'NEAL “I don’t really do a lot of testimonials, but this really works! I came across Power Balance when someone did the test on me. That night, while playing for the Phoenix Suns, there were about three of my teammates with the product on and we won that game by 57 points! I kept feeling something when I wore the bracelet, so I kept wearing it. When I took it off I went back to normal. I’ve been wearing the bracelet ever since. I want to do everything to get the slightest advantage; wristbands, necklaces, t-shirts, band-aids, everything and anything we can get our hands on. I’m here to tell you it works!”

  36. How does it do that? • According to the company: • ...its Performance Technology that uses holograms embedded with frequencies designed to work positively with your body’s natural energy field • --Power Balance website • http://www.powerbalance.com

  37. Offer • I can get you these for 1/2 off the website’s selling price of $30 • You can take home one of the used ones today for $10 • Anybody interested?

  38. Offer • I can get you these for 1/2 off the website’s selling price of $30 • You can take home one of the used ones today for $10 • Anybody interested? • What would it take to persuade you?

  39. Turn in… • Write names of all group members and hand in

More Related