1 / 9

Review – Chapter 4

Review – Chapter 4. Chapter 4. Name three differences between plant and animal cells. A – What is the purpose of the ribosome? A – What is the power house of the cell? A –. Cell Parts Continued. What is the purpose of the endoplasmic reticulum? A – How do proteins leave the cell?

kenna
Download Presentation

Review – Chapter 4

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Review – Chapter 4

  2. Chapter 4 • Name three differences between plant and animal cells. A – • What is the purpose of the ribosome? A – • What is the power house of the cell? A –

  3. Cell Parts Continued • What is the purpose of the endoplasmic reticulum? A – • How do proteins leave the cell? A – • What would happen if the nucleus of a cell was taken out? A –

  4. DNA • Where is DNA found? A – • What does DNA stand for? A – • What shape does DNA take? A – • What three parts make up DNA? A –

  5. DNA • What does A, G, C and T stand for? A – • What does adenine pair with? A – • Most of the time, DNA exists in the nucleus in the form of what? A – • What does DNA code for? A –

  6. Chromosomes • How many pairs of chromosomes are found in human cells? A – • If your 23rd pair of chromosomes is XY, you would be a … A – • Small segments of DNA are called what? A -

  7. Genes/Proteins • What is the importance of genes? A – • Which of the following are not specialized proteins: hormones, nucleolus, enzyme? A – • Why are stomach cells different from skin cells? A –

  8. Protein Production • What does RNA stand for? A – • How is the message for a protein to be made carried from the nucleus to the ribosomes? A – • What is the function of the Golgi body? A –

  9. Mutations • What type of mutation is occurring in the following DNA sequence (and where): CATGCCTGACGTCTGATGCCA Mutation 1: CATGCCTGACCTCTGATGCCA A – Mutation 2: CATGCCTGACGTCTGATGCCAA A – Mutation 3: CATCCTGACGTCTGATGCCA A –

More Related