1 / 44

Infections and Psychiatric Diseases Lecture Outline

Clinical and Epidemiologic Features of Schizophrenia and Bipolar Disorder Biology of Endogenous Retroviruses Role of Herpesviruses in Retroviral Transcription Clinical Epidemiology of Herpesvirus Infections and Psychiatric Diseases Clinical Trials of Antimicrobial Agents.

kolton
Download Presentation

Infections and Psychiatric Diseases Lecture Outline

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Clinical and Epidemiologic Features of Schizophrenia and Bipolar Disorder Biology of Endogenous Retroviruses Role of Herpesviruses in Retroviral Transcription Clinical Epidemiology of Herpesvirus Infections and Psychiatric Diseases Clinical Trials of Antimicrobial Agents Infections and Psychiatric DiseasesLecture Outline

  2. Schizophrenia and the Clinical LaboratoryOpportunities and Challenges • Opportunities • Common Disease (1% of American Population) • Availability of more easily tolerated medications • Challenges • Rudimentary knowledge of disease pathogenesis • No relevant animal models or cell lines • No laboratory tests • Minimal prediction of response to medication

  3. Schizophrenia and Bipolar DisorderClinical Features • Schizophrenia • Positive Symptoms • Hallucinations, Delusions, Disordered Thinking • Negative Symptoms • Withdrawal, Amotivation, Restricted Expressiveness • Impairment in Cognitive and Social Functioning • Lifetime prevalence ~ 1% worldwide • Bipolar Disorder • Mania • Depression • Variable degree of positive and negative symptoms • Variable degree of cognitive impairment • Lifetime prevalence ~0.5% worldwide

  4. A Beautiful MindHollywood or Reality

  5. A Beautiful MindHollywood vs Reality? • Reality • Onset of schizophrenia without clear cause • Attractiveness of delusions • Role of medication • Disease “burn out” at later age • Hollywood • Delusions coinciding with creativity • Shock therapy used at “high class” hospital • Family support

  6. Schizophrenia and Bipolar DisorderBiological and Epidemiological Features • Lifelong illness with peak onset in early adulthood. • Range of structural and functional brain abnormalities visible on fMRI and PET scans. • Abnormal expression of brain receptors • Dopamine • Glutamate • Massive social and economic consequences • Available medications • Control symptoms in many patients • Have a high rate of side effects • Do not appreciably alter the course of disease

  7. Microbial Agents and SchizophreniaEpidemiological Findings • Specific Infectious Agent • Perinatal Rubella (Brown et al, 2001; OR~3.5) • Neonatal Enterovirus (Jones et al, 1998 OR~4) • Maternal Herpesvirus (Buka 2001; OR~4) • Possible Infectious Exposure • Seasonality of Birth (Torrey at al, 1998; OR~2) • Urban Birth (Mortenson et at, 1999, OR~2.5) • Fever in Pregnancy (Torrey et al 2000, OR~3) • Pre-eclampsia ( Dalman et al, 1999, OR~2.5) • Case Reports • HIV • Herpes Simplex Virus 1/2 • Toxoplasma gondii

  8. Genetics Of Schizophrenia and Bipolar Disorder • Increased Incidence in BiologicalFirst Degree Relatives • General Population  1% • First Degree Relatives 7-9% • Monozygotic Twins  30% • Most individuals with schizophrenia do not have a first degree relative with this disease. • Genetic factors have a largerelative risk but a small risk in the overall population(5%) • Intensive search for genes using molecular methods • Multiple chromosomal regions of linkage • Single nucleotide polymorphisms of minor effect in selected populations (OR~2) • No genes of major effect in different populations

  9. Mendel-Human traits are determined by individual genes which function independently of other genes and of environmental influences Koch-Many human diseases are caused by microbes which exert their effect independently of other microbes, environmental factors and genes Complex Human DiseasesBeyond Koch and Mendel

  10. Microbial Agents and Human Disease Koch’s Postulates • Principles • Specific infectious agents cause clearly delineated disease states • The diseases cannot exist without the specific agent • Etiologic agents cause disease in animal models • Limitations • Shared pathways of response to infection • Genetic determinants of response • Individual variation in response to infection • Limited animal models of complex human diseases

  11. Complex Human DiseasesBeyond Koch’s Postulates • Most common human diseases are caused by the interaction of environmental insults and susceptibility genes. • Many of the susceptibility genes are diverse determinants of human response to environmental factors to infection. • Informative laboratory methods for complex disorders have to address both genetic and environmental factors. • Prevention or treatment of the infections may result in the effective treatment of complex disorders: • Helicobacter-Peptic Ulcer • HPV-Genital Cancer • Chlamydia-Cardiac Disease?

  12. Etiology of Complex Human DiseasesRelative vs. Attributable Risk • Relative Risk-Chance of an individual with an exposure acquiring a disease relative to the general population • Population Attributable Risk-Percentage of the population with a disease which can be attributed to a specific factor • Diseases of single or limited etiologies-High relative and attributable risks • CFTR gene-Cystic Fibrosis • HIV-Acquired Immunodeficiency Syndrome • Complex Human Diseases Factors with high relative risk may have low attributable risks if exposures are rare • Apoliprotein genes-Alzheimer’s Disease • Maternal alcohol-Fetal malformations • M tuberculosis-Lung Disease

  13. Factor Relative Risk Affected Father 7.2 Affected Mother 9.3 Affected Sibling 7.0 Urban Birth 2.4 Winter Birth 1.1 No Factor 1.0 Epidemiology of SchizophreniaRelative vs. Attributable Risk Mortenson et al, NEJM 340:603, 1999

  14. Factor Relative Risk% Cases In Population Affected Father 7.2 1.2% Affected Mother 9.3 2.4% (No affected parent) 88.8% Affected Sibling 7.0 2.2% (No affected sibling) 97.8% Urban Birth 2.4 32.9% Winter Birth 1.1 25% Epidemiology of SchizophreniaRelative vs. Attributable Risk Mortenson et al, NEJM 340:603, 1999

  15. Risk FactorPopulation Attributable Risk Affected Parent 3.8% Affected Sibling 1.9% Affected Parent or Sibling 5.5% Place of Birth 34.6% Season of Birth 10.5% Place and Season of Birth 41.4% All Variables 46.6% Epidemiology of SchizophreniaRelative vs. Attributable Risk Mortenson et al, NEJM 340:603, 1999

  16. SchizophreniaWorking Hypotheses • Most cases of schizophrenia are the result of infections and other environmental insults occurring in genetically susceptible individuals before the onset of clinically apparent symptoms. • Distinct gene-environmental interactions may be operant in different populations. • Interactions do not follow Koch’s postulates. • The role of specific infectious agents can be defined by clinical trials of anti-microbial chemotherapy.

  17. Identification of Infections in Schizophrenia Methods-Old and New • Analytic Methods • Differential Display PCR • Library screening • Microarrays • Two-dimensional electrophoresis • Enzyme immunoassays • Samples for Analysis • Brains collected by the Stanley Neuropathology Consortium • Cerebrospinal fluids (CSF’s) from individuals with recent onset schizophrenia • Blood samples from mothers of infants who developed schizophrenia in adult life.

  18. Differential Display PCRBrain from Individual with Schizophrenia (S) and Unaffected Control(U) M S U S U S U M

  19. HIV Human Endogenous Retrovirus HERV-W

  20. Endogenous RetrovirusesBorderland Between Viruses and Genes • Integrated Genomic Elements with Homology to Retroviruses Arising from Germ Line Integration of infectious viruses during evolution • All Primates • Old World Monkeys • Apes • Humans • Individuals

  21. Endogenous RetrovirusesBorderland Between Viruses and Genes II • Dynamic Effects on Gene Function • Promoter control of adjacent genes- PLA2; Placental Genes • Interaction with infectious agents-Herpesviruses, Toxoplasma • Interaction with soluble mediators-Hormones; Cytokines • Functionality of viral proteins-Syncytin; amino acid transporters • Role in Human Disease • Diabetes-Superantigen activation • Multiple Sclerosis- Glial cell function • Autoimmune Arthritis- T cell activity • Pre-Eclampsia-Aberrant Fusion of Trophoblasts

  22. Microbe Hormone Mediator Endogenous RetrovirusesActivation and Transcription DNA 5’LTR Viral Proteins 3’LTR

  23. K113 Endogenous RetrovirusesBorderland Between Viruses and Genes • Integrated Genomic Elements with Homology to Retroviruses Arising from Germ Line Integration of infectious viruses during evolution • All Primates • Old World Monkeys • Apes • Humans • Individuals Herv-W

  24. Endogenous Retroviral PCR CSFs:Schizophrenia and Controls Scz DNA Ctr Herv-W HERVw GTTCAGGGATAGCCCCCATCTATTTGGCCAGGCATTAGCCCAAGACTTGAGTCAATTCTCATACCTGGACACTCTTGTCCTTCAG C1 ---------------------------------------------------C--------------------------------- A1 ------------------------------A---------------------------------------------------TG- A2 ------------------------------A---------------------------------------------------TG- A3 ----------------------------------C----------------C--G----------------------------G- A4 -----------A----------------------------T----------C--G---------------------------TG- A5 -----A------------------------------------------------------------------------------- A6 ------------T------------CA---TA-------------------C--G---------------------------TG-

  25. Herv-W EnvelopeChromosomal Distribution

  26. Herv-W and Amino Acid TransportersLavillette et al, J Virol Jul;76(13):6442-52.

  27. ASCT1 HERV-W ReceptorBrains of Cases and Controls P<.02 P<.005 P<.009 Cingulate Gyrus

  28. Reverse Transcriptase Activity Retrovirus HSV-1 Human Endogenous RetrovirusesActivation by HSV-1Perron et al J Gen Virol. 1993 Jan;74 ( Pt 1):65-72.

  29. Cognitive Functioning and Antibodies to Infectious Agents Individuals with Schizophrenia (N=229) Antibody Positive Antibody Negative 80 ** * 75 Cognitive Score (RBANS Total) 70 65 60 HSV-1 Toxo CMV HSV-2 EBV HHV-6 **p<.00001 Infectious Agent (IgG Antibodies) *p<.009

  30. HSV-1 Pos N=101 Immediate Memory Concentration Language Attention Delayed Memory RBANS Total 50 55 60 65 70 75 80 85 90 Score(Mean+/-95% Confidence) Cognitive Deficits In Individuals with SchizophreniaRelationship with Antibodies to HSV-1 HSV-1 Neg N=128 *** *** * * ** ** * * *** *** *** p<.0001 *** p<.0001 **p<.001 **p<.001 * p<.009 * p<.009

  31. Cognitive FunctioningAssociation with HSV-1 Serostatus

  32. Cognitive Function in Schizophrenia and Bipolar DisorderHSV-1 Antibodies and Quintile of Total Score

  33. Collaborative Perinatal StudyStudy Design • 65,000 healthy mothers enrolled from 1957-1964 from 11 geographically diverse sites. • Mothers followed closely during pregnancy. • Neurocognitive and developmental testing during first 7 years of life. Primary outcomes cerebral palsy and mental retardation. • Serum samples obtained from mothers during pregnancy and infants at birth (cord). • Offspring identified with psychiatric diseases in 1990’s and matched to maternal and cord blood serum specimens. • Unselected offspring evaluated for abnormalities of pregnancy, birth, and child development.

  34. Schizophrenia in Adult LifeInfection During Fetal Development 6.00 4.80 3.60 Odds Ratio 2.40 1.20 0.00 CMV IgG CMV IgM Rub IgG Rub IgM Toxo IgG Toxo IgM HSV1 IgG HSV2 IgG Herv W

  35. Effect of HERV-K and HSV-1 on Eclampsia and Mental Illness

  36. Unadjusted Adjusted for Race, SES 4.50 4.00 3.50 3.00 Odds Ratio 2.50 2.00 1.50 1.00 0.50 0.00 Abnormal Speech Low IQ Abnormal Vision Any Complication Fetal Deaths Effect of Maternal HSV-2 on Pregnancy and Child Development Age 7-8 Perinatal

  37. Valacyclovir Clinical TrialIndividuals with Schizophrenia • Enrollment of 66 patients with stable schizophrenia on standard medication given Valacyclovir 2 gm/day for 16 weeks • Evaluation by the positive and negative symptom score (PANSS) • Change in score correlated with viral antibody status at start of study • HSV1/2 • CMV • Other herpesviruses

  38. Response to ValacyclovirHSV-1 Antibody Status HSV-1 Seropositive HSV-1 Seronegative Positive Symptoms Total Symptoms

  39. Negative Scale Positive Scale 30 20 20 10 Percentage Improvement 10 0 0 -10 -10 2 4 8 12 16 2 4 8 12 16 2 Response to Valacyclovir by CMV Status P<.006 General Scale Total Score 20 20 P<.02 P<.0005 10 10 Percentage Improvement 0 0 -10 -10 4 8 12 16 2 4 8 12 16 CMV Seropositive CMV Seronegative

  40. Prevalence of CytomegalovirusPopulations with Schizophrenia Cologne-Untreated Cologne-Recent Onset- Treated Cologne-Control Heidelberg-Recent Onset- Treated Heidelberg-Control Baltimore-Stable Treated Baltimore-Control 0 10 20 30 40 50 60 70 80 Prevalence (%)

  41. Effect of Valacyclovir on SchizophreniaPossible Explanations ? • Statistical artifact ? • p<.0005 with covariance for multiple factors • Placebo effect? • Improvement only in CMV seropositive subjects • Improvement persists throughout treatment • Non-viral effect of valacyclovir/acyclovir? • Effect only in CMV seropositive individuals • The replication of CMV contributes to the symptoms of schizophrenia in some individuals • Possible role of an antigenically related herpesvirus?

  42. Valacyclovir Treatment of Schizophrenia-Planned Trials • Placebo-control trials using encapsulated valacyclovir and placebo • Stable patients with schizophrenia • Recent onset patients with schizophrenia • Patients with bipolar disorder • High-risk individuals with prodromal symptoms • Study supported by the Stanley Medical Research Institute, without support from the pharmaceutical industry.

  43. Infections and SchizophreniaConclusions • Recent onset schizophrenia is associated with: • Increased transcription of HERV-W • Increased levels of antibodies to CMV • Past infection with HSV-1 is associated with cognitive impairment in individuals with stable schizophrenia andbipolar disorder, but not in unaffected controls. • Maternal exposure to infectious agents is associated with an increased rate of schizophrenia in the offspring. • The administration of valacyclovir can reduce symptoms in some individuals with stable schizophrenia. • The continued evaluation of the role of the prevention and treatment of infection in the management of psychiatric diseases remains a high priority.

  44. Johns Hopkins University Loraine Brando Frances Yee Vern Caruthers Inna Ruslanova Bogdana Krivogorsky Stanley Medical Research Institute Michael Knable Maree Webster Sheppard Pratt Hospital John Boronow Catherine Stallings Harvard University Steve Buka Ming Tsuang University of Heidelberg Silke Bachmann Johannes Schroeder Karolinska Institute Håkan Karlsson University of Cologne F Markus Leweke Microbial Agents and SchizophreniaAcknowledgements

More Related