Biotechnology – Gel Electrophoresis

1. Biotechnology – Gel Electrophoresis How We Analyze DNA So That We Can Do Stuff With It.

2. A brave new world?

3. Biotechnology • Manipulating genes to suit our purposes is nothing new. • Crossbreeding / Selective Breeding • Picking organisms with traits you like and breeding them • Goal is to get babies with traits that you REALLY like. • Trouble is that Cross/Selective breeding is not terribly precise • You may not get the results you want • May recombine other traits in ways that were not intended, etc.

4. Biotechnology today • Genetic Engineering • Direct manipulation of DNA • Allows much more specific control over particular genes • Fewer unintended results • However, if you are going to engineer DNA & genes & organisms, then you need a set of tools to work with • this is a look at one of those tools… Our tool kit…

5. To manipulate DNA, we first need to be able to cut it up • WHY? • Really it’s our only means of being able to analyze it • Also, if we’re going to take certain parts that we like OUT of one organism’s DNA and stick them into another organism’s DNA, then we need to be able to “cut and paste” • So how the heck can we cut up DNA?? • Breaking out the scissors will NOT work. • The answer is…. • ENZYMES!

6. How do we cut DNA? • Restriction enzymes • restriction endonucleases • discovered in 1960s • Occur naturally in bacteria • Protect bacteria against viruses & other bacteria 

7. So what do restriction enzymes do? • Do they just hack DNA up into bits? • Well, sort of, but they only do it at certain, very predictable, locations along the DNA sequence • The places where the restriction enzymes cut DNA are called restriction sites • Specific sequences of “letters” on the DNA strand recognized by Restriction enzymes

8. CTG|AATTCCG GACTTAA|GGC Madam I’m Adam Restriction enzymes • Action of enzyme • cut DNA at specific sequences • restriction site • Many different kinds of Restriction enzymes • named after organism in which they are found  CTGAATTCCG GACTTAAGGC 

9. Many uses of restriction enzymes… • Now that we can cut DNA with restriction enzymes… • Not only can we cut DNA out of the genome of one organism and stick it in another… • Glow in the dark jellyfish gene inside of a mouse • Human insulin gene inside of bacteria • But we can also cut up DNA from different people… or different organisms… and compare it • For what purpose? • forensics • medical diagnostics • paternity • evolutionary relationships • and more…

10. How do we compare cut up DNA? • Compare DNA fragments by separating them according to SIZE. • So, how do we separate DNA fragments according to size? • We can’t see all the little pieces and pick them out with our fingers! • run them through a “strainer” to sort them • Gelatin is the strainer • gel electrophoresis

11. Gel electrophoresis • A method of separating DNA in a gelatin-like material using an electrical field • DNA is negatively charged • when it’s in an electrical field it moves toward the positive side DNA         – + “swimming through Jello”

12. Gel electrophoresis • DNA moves in an electrical field… • so how does that help you compare DNA fragments? • size of DNA fragment affects how far it travels • small pieces travel more quickly through the gel • large pieces travel slower & lag behind DNA        – + “swimming through Jello”

13. Gel Electrophoresis DNA &restriction enzyme - longer fragments wells power source gel shorter fragments completed gel +

14. Gene 1 cut sites repeats cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGA GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGA Different people have different DNA Great…But how does the fact that different size pieces of DNA move at different speeds through a gel HELP us ANALYZE the DNA???? Cut the DNA 1 2 3 – + DNA gene 1

15. Differences between people Gene 1 cut sites cut sites GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGA Gene 2 GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCT CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGG 1 2 3 DNA fingerprint – + DNA allele 1 allele 2

16. 1 2 3 4 5 1 2 3 4 5 Uses: Evolutionary relationships • Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA  +

17. Uses: Medical diagnostic (genetic testing) • Comparing normal allele to disease allele chromosomewith normal gene 1 chromosome with disease-causing gene 2 Gene 2 Gene 1 – DNA  Example: genetic test for Huntington’s disease +

18. Uses: Forensics • Comparing DNA sample from crime scene with suspects & victim suspects crime scene sample S1 S2 S3 V – DNA  +

19. DNA fingerprints • Comparing blood samples on defendant’s clothing to determine if it belongs to victim • DNA fingerprinting • comparing DNA banding pattern between different individuals • ~unique patterns

20. Electrophoresis use in forensics • Evidence from murder trial • Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman “standard”

21. Mom F1 F2 child Uses: Paternity • Who’s the father? – DNA  +

22. I’m a-glow! Got any Questions?

23. In reality, much of each person’s DNA is identical to every other person… • Don’t want the genes for important proteins to be messed up, do we????? • So How/Why is each person’s DNA pattern different? • There are big sections of “junk” DNA within our genomes • “Junk” DNA doesn’t code for proteins • made up of repeated patterns • CAT, GCC, and others • each person may have different number of repeats • Why are these repeated patterns there? Not entirely clear… • many sites are found on our 23 chromosome pairs with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACG CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGC