1 / 17

DNA

DNA. By: Mr. Kauffman. Outline. DNA background information Discovering DNA DNA structure How DNA works Storing DNA. DNA Background Information. DNA : Deoxyribonucleic Acid It is the genetic/hereditary material found in all cells Stored in the nucleus

lana-kane
Download Presentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA By: Mr. Kauffman

  2. Outline • DNA background information • Discovering DNA • DNA structure • How DNA works • Storing DNA

  3. DNA Background Information • DNA: Deoxyribonucleic Acid • It is the genetic/hereditary material found in all cells • Stored in the nucleus • Contains the information that determines what we look like

  4. DNA Background Information Contains the information to control a cell’s growth and function, but… Only tells how to make things Other parts (proteins) of the cells actually do the work

  5. DNA Background Information • DNA Analogy • DNA is like a cookbook • It tells how to make something, but it doesn’t actually make it • Your DNA contains the instructions for how to make you

  6. DNA Background Information • Every “normal” cell in your body has the same DNA in it • Skin and muscle cells are normal cells • When a cell divides, the DNA inside the cell is copied and each new cell gets 1 copy of it

  7. Discovering DNA • Scientists have known about DNA since the 1800’s • 1952 • Rosalind Franklin discovered that DNA was made up of 2 chains in a spiral shape • 1953 • James Watson and Francis Crick made a model of DNA

  8. DNA Structure • Known as a Double Helix • Meaning there are 2 sides in a spiral shape • More commonly called a twisted ladder

  9. DNA Structure Outer parts of the DNA ladder are called the sugar-phosphate backbone Alternating sections of sugar and phosphate

  10. DNA Structure • The rungs of the DNA ladder are made up of nitrogen bases • There are 4 types of nitrogen bases 1. Adenine (A) 2. Cytosine (C) 3. Guanine (G) 4. Thymine (T) • The bases are always found in pairs • Adenine (A) always pairs with Thymine (T) • Cytosine (C) always pairs with Guanine (G) • They fit together like puzzle pieces

  11. DNA structure • Draw the picture on the left in your notes • Provide the base that each base you have been given would pair with

  12. DNA structure

  13. How DNA works • The sequence of the DNA bases determines the information contained in the DNA • A sequence of 3 bases is called a codon • A codon = an amino acid • There are 20 different amino acids • Each one is controlled by a specific set of 3 bases • ACGGCAATTGCTTTTAAGCCA • ACG , GCA , ATT , GCT , TTT, AAG , CCA

  14. 20 Amino Acids

  15. Storing DNA • DNA is stored in the nucleus of the cell • Stored as chromosomes • How many chromosomes do humans have? • Every “normal” human cell has 46 single chromosomes, or 23 pairs of chromosomes • Each chromosome contains DNA with different information in it

  16. Storing DNA Human Chromosome Chart

  17. Storing DNA Actual Human Chromosomes

More Related