1 / 77

Cross section of rat testis Showing Seminiferous Tubules and Interstitium

Cross section of rat testis Showing Seminiferous Tubules and Interstitium. Kent Christensen, Univ. Michigan. Functional and Anatomical Compartments of the Testis.

levana
Download Presentation

Cross section of rat testis Showing Seminiferous Tubules and Interstitium

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Cross section of rat testisShowing Seminiferous Tubules and Interstitium Kent Christensen, Univ. Michigan

  2. Functional and Anatomical Compartments of the Testis

  3. Interstitium of rat testis showing endothelium, Leydig cells (L), and macrophages (arrow). Note close association of macrophages and Leydig cells. Scott Miller, Univ Utah

  4. Close association of Leydig cell and macrophage, lower panel shows close up of “digitation” of Leydig cell process extending onto macrophage surface. Scott Miller, Univ. Utah

  5. Macrophage-Leydig cell interactions Cytokines, ROS ?

  6. LH Extracellularlipoprotein Cholesterolpool acetate ATP cAMP cholesterol PKA+ DYm Pregnenolone ++ Transcription 3bHSD Progesterone P450c17 Androstenedione 17bHSD TESTOSTERONE

  7. P450c17 is sensitive to transcriptional repression • Of all the steroidogenic enzymes, P450c17 is the most sensitive to repression • Most cytokines tested inhibit c17 transcription: • IL-1a/b, IL-2, IL-6, TNFa, TGFb, INFa/b, INFg • Inflammatory mediators: PGF2a, ceramide, vasopressin, PKC agonists • Environmental disruptors such as dioxin, pthalates, PAHs, etc. are inhibitory • Androgen-mediated feedback repression

  8. IL-1, TNF and PMA vs. Testosterone production

  9. IL-1, TNFa and PMA vs. steroidogenic mRNA expression P450scc P450c17 +IL-1 cAMP +PMA +TNFa

  10. cAMP responsive regions of the Cyp17promoter

  11. TNF inhibits Cyp17 promoter activity

  12. Calphostin reverses TNF inhibition of Cyp17 promoter

  13. TNFa and PMA stimulate translocation of PKCa from cytoplasm to membrane control No antibody PMA TNFa

  14. Putative transfactor binding sites

  15. Comparison of cAMP-responsive sequences in mouse and rat Binding sites (ATF2/cjun-like,Steroidogenic factor 1,StF-IT-2, andStF-IT-1/COUP-TF1) are shown in bold color in the sequence for the species in which it was identified. Those that are conserved between species are underlined. Sequence differences are shown in blue for mouse and pink for rat.

  16. Characterization of the Cyp17 Promoter Revealed a Region Between -245 and -346 Responsible for the Minimal cAMP Responsiveness of the Gene

  17. Site-directed mutagenesis of Cyp17 CRR (-346 to –245) • Oligos were designed to place an XhoI once every ten base pairs within the 100 base pair CRR. • This resulted in changing as few as three (mutant 6) to as many as six (mutant 1 and 7) of every ten nucleotides. • Mutagenesis was performed with Altered Sites (Promega) and all mutants were verified by sequencing.

  18. Cyclic-AMP induction of CRR mutants

  19. cAMP Induction of CRR mutants

  20. Putative sites revealed by mutants gcaacctgatgacattaatt attaactgtg cagcacttttgacattacag CTCGAGtgat CTcGAGaatt CtCGaGtgtg cTCGaGtttt CTcGAGacag mut 1 mut 2 mut 3 mut 4 mut 5 cacgcactctgaaaccttga tcttaatctg atagcatttg cctctgggag cTcgAGctct CTCGAGttga CTCGaGtctg CtCgAGtttg cACGAgggag mut 6 mut 7 mut 8 mut 9 mut 10 ATF2 AhR/Arnt(core sequence) SF-1

  21. ATF2 mutants 2,5,9 C/EBPb– upstream site AhR/ARNT mutant 6 SF-1 mutant 7 ARE Putative regulatory motifs revealed by mutagenesis ? -250 -440

  22. The Minimal cAMP Responsive Region of the Cyp17 Promoter (CRR): -346 TGATGACATTAATTATTAA CTGTGCAGCA CTTTTGACATTACAGCACGC ACTCTGAAAC CTTGATCTTA ATCTAGCATTTGCCTCTGGG AGGATCCATA GCG -245 -346 -245 Putative ATF-2 binding site

  23. Binding of Nuclear Proteins to the CRR Probe is Augmented by Treatment of MA-10 Cells with cAMP

  24. Nuclear Proteins from Primary Leydig Cells Form Two Complexes with the CRR Probe

  25. The Upstream ATF-2 C/EBPb Binding Site -450 TTGTGTGACCTTATGCAAAC TAACCCA -423 -245 -450

  26. Nuclear Proteins from Control and cAMP-Treated MA-10 cells Bind to the Upstream ATF-2 C/EBPb Probe

  27. Incubation of the Upstream ATF-2 C/EBPb probe with Nuclear Proteins Isolated from Primary Leydig Cells Results in Complex Formation

  28. Formation of the Higher Order Complex Formed by the CRR Complex is Decreased by Addition of Unlabeled ATF-2 or C/EBPb Competitor Oligos

  29. Binding of Nuclear Proteins to the Upstream ATF-2 C/EBPb Probe can be Inhibited by Addition of ATF-2 or C/EBPb Competitor Oligos

  30. Overexpression of C/EBPb Induces Transcription of the -491/-255 Cyp 17 reporter

  31. ATF-2 Expression in MA-10 Cells is Not Affected by cAMP Treatment

  32. C/EBPb Expression is Significantly Increased in MA-10 Cells with cAMP p38 p34 **

  33. Summary of Cyp17 study • TNFa-mediated inhibition of transcription involves activation of PKC • ATF2 and C/EBPb participate cooperatively in cAMP-induction of transcription • ATF2 is constitutively expressed • C/EBPb expression is induced by cAMP

  34. Hypotheses • ATF2 and C/EBPb interact as heterodimers binding to the “ATF2” sites in the promoter • The stoichiometry of C/EBPb and ATF2 interaction is critical to driving transcription • Repressors may act by inhibiting C/EBPb expression or through post-translational modifications that inhibit its activity • C/EBPb phosphorylation by PKC may block it from interacting with ATF2

  35. P450scc P450c17 3b-HSD actin - + - + - + - + - + LPS 2h 4h 6h 8h 24h time Effect of LPS on steroidogenic mRNA levels

  36. LPS vs. serum testosterone: 2-24 hours control 14 LPS 12 10 8 Testosterone (ng/ml) 6 4 2 0 2 h 4 h 6 h 8 h 24 h Time post LPS

  37. Steroidogenic Acute Regulatory Protein: StAR • Essential for steroid hormone biosynthesis • Cyclic-AMP dependent expression • Facilitates cholesterol transfer across inner-mitochondrial (aqueous) space • Translated as a 37 kDa precursor protein that is processed to the 30 kDa mature form as it translocates into the mitochondria • Cholesterol transport activity depends on intact DYm

  38. StAR facilitates cholesterol transfer

  39. Pulsatile nature of cholesterol flux into the mitochondria

  40. N' 32 kDa N' 30 kDa 37 StAR Processing 32 30 Inner-mitochondrial forms Cytosol 37 kDa N' cholesterol transfer critical region signal peptides Outer mitochondrial membrane Inner- mitochondrial membrane matrix

  41. StAR N-terminal localization expression clones MTS 1-37 ITS 38-47 pCMV-StAR TAA StAR-stop MTS 1-37 StAR D-ITS StAR D-N47 Tom20 OMTS StAR/Tom20 CCHL IMSS StAR/CCHL

  42. What mediates the acute LPS inhibition? • Tested numerous inflammatory mediators in Leydig cells in vitro-- none mimicked the acute LPS “effect” • cytokines (TNFa, IL-1, IL-6, IFNg, TGFb) • prostaglandins (PGF2a, PGE) • catecholamines (norepi, isoproteranol) • ceramide (C2, C8) • Most nitric oxide donors (Sin-1, SNAP, SNP, Nor-3) • Calcium inophore (A23187)

  43. LPS vs. StAR protein expression: 2 hr after injection 37 kDa 30 kDa con LPS

  44. Carbonyl cyanide m-chlorophenylhydrazone (cccp) • Carbonyl cyanide m-chlorophenyl-hydrazone (cccp): potent uncoupler of oxidative phosphorylation; protonophore, mitochondrial disrupter. • Causes transient disruption of DYm

  45. H+ DYm e- Mitochondrial respiration, OX-PHOS and DYm

  46. CCCP Vs. Progesterone in MA10s

  47. Effect of CCCP on StAR protein 37 kDa 30 kDa Control cAMP cAMP + cccp cccp

More Related