1 / 6

Genetic Study on Liver Tumor Development and Methylation Patterns

Analyzing the role of genetic variations and methylation patterns in liver tumor development using paired tumor and non-tumor liver samples. Findings shed light on potential biomarkers and mechanisms.

liseli
Download Presentation

Genetic Study on Liver Tumor Development and Methylation Patterns

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Table S1

  2. Figure S1 GTTGGGTGATCAAATCCCAAGTTGTAGCTCTCGATGGGTCGAGGGCGATGGCCAGCGCTGTGCTGGGAACGGGCAGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCTGCCCCACATGGGCGCAGGAGGCCTCCGCACGCGCAAGGGCCAAGGGCTGGAGGGGGCTCTCCCGGGCACAGGCACCGGACCCGGGGCGCGCGCGCGCGTCCTTAGTCCCCGGGCTGCACTCCGGGCCGCTGAGAGATCGGGTCCCAGAAGTTCCGGGAGTGGTCGGGTGACCCTGGAACTTTCTTCTTCTGGAGCCCGACCTGGGGCTGACTGCAGAGCAGGCTGCTGGCAGGGACCAAAAGGAGCTCCGCGCCAGGCCGGAGGCTGCGCCCGTCACTCGCGGTCCCGGCCGGGTCCCTGGCGCGTAGTCAGGCCGCACCGCCCGAGCCCCACCGCGCGCCCACCCCGGCCGGGTGCGTCCGGCTCGCGGCCGTCCCTCCCGCGACCTGTGGCCCGGGGCTGCTGCGGGCGCCCGGGGAAGAGAGGCGGGGGCCGCGGGGGGCAGGAGGAGCGGCTGCGGCCGGCACAGCGCCAGGGCGAGTGAGGCGGGTGGCGCGGGGGAGGCGGCGGAGTAAAGAGAGGCCGCCGGCTGGGTCCGCGGGTCACTCCGAGGCGCGGGCTGCGGGCGGCGGGCGGCGGGCGCACCATGCCCTCCTTCGACGAGGCGCTGCAGCGGGTGGGCGAGTTCGGGCGCTTCCAGAGGCGCGTGTTTTTGCTGCTGTGCCTGACGGGCGTCACCTTCGCCTTCCTCTTCGTCGGCGTGGTCTTCCTGGGCACGCAGCCCGACCACTACTGGTGCCGCGGGCCAAGTGCCGCGGCGCTGGCCGAGCGCTGCGGCTGGAGCCCGGAGGAGGAGTGGAACCGCACGG

  3. Figure S2

  4. Figure S3 c-Etc-1 MZF-1 MyoD -146 /MZF-1 Sp1 AP-4 -124 AP-4 -81 /p300 MZF-1 Sp1 Sp1/Oct-1/HNF-3/TBP TSS Ap-1/p300 Sp1 +2 -2

  5. Figure S4 Cell line methylation Study Tissue expression study Tissue Methylation study

  6. Figure S5 Paired Non-tumor liver samples Paired Tumor liver samples TLV1 NLV1 TLV2 NLV2 TLV3 NLV3 TLV4 NLV4 NLV5 TLV5 NLV6 TLV6

More Related