1 / 24

Phylogeny & The Tree of life

Chapter 26. Phylogeny & The Tree of life. Phylogeny: Evolutionary history of a species or group of species Determined by evidences from fossil record , homologous structures, molecular homologies Systematics : Helps us understand phylogeny (data analysis of phylogeny).

lucian
Download Presentation

Phylogeny & The Tree of life

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Chapter 26 Phylogeny & The Tree of life

  2. Phylogeny: • Evolutionary history of a species or group of species • Determined by evidences from fossil record, homologous structures, molecular homologies • Systematics: • Helps us understand phylogeny (data analysis of phylogeny) Phylogeny & Systematics

  3. Phylogenies show evolutionary relationships 26.1

  4. Grouping according to evolutionary similarities • Binomial nomenclature (Linnaeus) • Domains  Species • Taxon (plural: taxa): named taxonomic hierarchy • Ex: Panthera is the taxon at the genus level Taxonomy

  5. Link phylogeny and taxonomy Phylogenic Trees

  6. Reading phylogenic trees

  7. Phylogenies are inferred from morphological and molecular data 26.2

  8. With ability to sequence DNA, we can easily show evolutionary relationships • EX: • Species 1: GAGATCTACACGGGGCCATGGAAAG • Species 2: GAGAACTACACGGGGCTATGGAAAG • Species 1: GAGATCTACACGGGGCCATGGAAAG • Species 3: GCCCACTATTATGGGCTATGGACCC DNA documentation

  9. Shared characters are used to construct phylogenic trees 26.3

  10. Science of constructing a cladogram Cladistics

  11. Clades • Groups of organisms sharing a common ancestor Cladistics

  12. A valid clade is monophyletic, it consists of the ancestor species and all its descendants Monophyletic

  13. A paraphyletic clade consists of an ancestral species and some, but not all, of the descendants Paraphyletic

  14. A polyphyletic clade includes many species that lack a common ancestor Polyphyletic

  15. Species Change Over Time (Nodes)

  16. Characteristics • Shared primitive character • Homologous structure that is older than the branching of a particular clade from other members of that clade • It is shared by more than just the taxon we are trying to define. • Example – mammals all have a backbone, but so do other vertebrates.

  17. Characteristics • Shared derived character • New evolutionary feature, unique to a particular group • Example - all mammals have hair, and no other animals have hair.

  18. Ingroup & Outgroup In: Group of study (make comparisons) Out: Group that diverged prior to ingroup

  19. An organism’s evolutionary history is documented in its genome 26.4

  20. Orthologous genes • Same gene, found in different species • Divergence traces back to speciation event • Ex: cytochrome c • Paralogous genes • Same gene, found in same species Genome evolution: Gene duplication

  21. Molecular clocks help track evolutionary time 26.5

  22. “Time” evolution by looking at how genes change Example: HIV Molecular clocks

  23. New information continues to revise our understanding of the tree of life 26.6

  24. 2 kingdoms to 3 domains

More Related