Protein-Nucleic Acid Interactions: General Principles

1. Protein-Nucleic Acid Interactions: General Principles

2. Roles of Protein Nucleic acid complexes Role: Structural Example: Histones & chromosomal proteins Function: DNA packaged into chromosomes Role: Regulatory Example: Transcription factors Function: Gene Regulation Role: Enzymatic Example: Polymerases, Restriction Endonucleases Function: Replication & Transcription

3. Nucleic Acid Structure Stabilizing forces hydrogen bonding van der Waals attractions Hydrophobic interactions

4. Base Pair Types • A.T Watson-Crick A.A N1-amino symmetric • G.C Watson-Crick A.C Reverse Wobble • A.U Watson-Crick A.A N7-amino symmetric • G.U Wobble G.G N1-carbonyl symmetric • A.U Reverse Hoogsteen G.G N3-amino symmetric • A.C Reverse Hoogsteen G.G N1-carbonyl,N7-amino • Sheared G.A G.A N7-N1 amino-carbonyl • G.A imino A.G N3-amino,amino-N1 • A.A.N7-amino C.C N3-amino symmetric • G.G.N7-imino U.U 4-carbonyl-imino symmetric • U.U imino-carbonyl U.U 2-carbonyl-imino symmetric • U.C 4-carbonyl-amino U.C 2-carbonyl-amino • A.U Reverse Watson-Crick • G.C Reverse Watson-Crick • G.U Reverse Wobble • G.C N3-amino,amino-N3 • A.U Hoogsteen

5. The morphology of DNA is dependent on the DNA sequence. Some sequences introduce bends in DNA for example These structural features are recognised by proteins, much like in the ‘lock and key model’ for enzymes Local DNA structure DNA is not a straight tube

6. DNA binding proteins ‘see’ the edges of the basepairs in the major or minor groove Major groove Minor groove

7. Structure of Glucocorticoid receptor

8. The protein ‘sees’ a particular array of these, which is different for each of the four base pairs Note that the edge pattern for G:C is different than the one for C:G What is it that these proteins interact with: Hydrogen bond donors Hydrogen bond acceptors Hydrophobic residues

9. These are the edge patterns a DNA binding protein would ‘see’ Notice that in the major groove, every base pair has a unique pattern, wherease the minor groove only has two distinct patterns. The major groove is therefore more informative than the minor groove

10. Protein structure • DNA binding Motif in protein molecules • Helix-turn-helix • Zn fingers (steroid receptor type) • Bzip (leucine zipper) • Parallel alpha helices • Anti-parallel beta strands Conformational Changes Unbound conformation bound conformation

11. Zinc-finger motif • Present in proteins that bind nucleic acids • Zn2+ ion is held between a pair of  strands and  helix

12. Zn-Finger motif

14. Leucine Zipper Motif 1YSA - Gcn4 Complex With Ap-1 Dna from Saccharomyces cerevisiae. Top Front Side

15. Helix Turn Helix Motif 3CRO – 434 Cro Protein Complex With DNA Containing Operator OR1 from Bacteriophage 434 Top Front Side

16. Based on structure comparisons it turned out that many bacterial DNA binding proteins contain a conserved domain of two alpha helices: helix-turn-helix motif What parts of the protein are involved in DNA recognition Mutations in helix 2 prevent DNA binding, which can be suppressed by mutations in the DNA sequence of the operator Swapping helix 2 between two different repressors also swapped the operator to which the proteins bind This shows that helix 2 is involved in DNA recognition

17. Helix 2 inserts into the major groove of DNA, whereas helix 1 lies across the groove Helix 2 interacts with the base pair edges Helix 1 contacts the sugar phosphate backbone

18. Specific amino acids, on the side of the helix facing DNA, interact with the base pair edges through hydrogen bonding The number of interactions between helix 2 and the DNA sequence determines the strenghth of DNA binding. Helix turn helix motif of Cro repressor protein (phage Lambda) Interaction between Cro and DNA Explains why the same protein can bind to different, yet related sequences with different affinities. We saw this for the LysR type proteins!

19. helix helix GCCACTTCAGATTTCCTGAATGCCTAC Many DNA binding proteins are dimers, e.g, the LysR type proteins and CAP This means that there are two helix-turn-helix motifs per dimeric protein These will interact with two adjacent major grooves, ie 10 bp apart (CbbR binding site, lecture 5) The DNA recognition site is therefore frequently an inverted repeat

20. The 434 cro molecule contains 71 amino acid residues that show 48% sequence identity to the 69 residues that form the N-terminal DNA-binding of 434 repressor. It is not surprising, therefore, that their three-dimensional structures are very similar. Like its lambda counterpart, the subunit structure of the DNA-binding domain of 434 repressor, as well as that of 434 cro, consist of a cluster of four  helices, with helices 2 and 3 forming the helix-turn-helix motif. The two HTH motifs are at either end of the dimer and contribute the main protein-DNA interactions, while protein-protein interactions at the C-terminal part of the chains hold the two subunits together in the complexes. Both 434 cro and repressor fragment are monomers in solution even at high protein concentrations, whereas they form dimers when they are bound to DNA.

21. The protein-DNA interactions have been analyzed in detail. Residues of the recognition  helix project their side chains into the major groove and interact with the edges of the DNA base pairs on the floor of the groove. Gln(Q)28 forms two hydrogen bonds to N6 and N7 of Ade1 in the base pair 1(T14’-A1), and Gln29 forms hydrogen bonds both to O6 and N7 of G13’ in base pair 2 (G13’-C2). At base pair 3 (T12’-A3) no hydrogen bonding to the protein occurs and direct contacts are all hydrophobic; The methyl groups of the side chains of Thr27 and Gln29 form a hydrophobic pocket to receive the methyl group of T12’.

22. The first three base pairs in all six operator regions recognized by phage 434 repressor are identical. This means that interactions between these three base pairs and the two glutamine residues (28 and 29) cannot contribute to the discrimination between the six binding sites in the DNA; rather, these interactions provide a general recognition site for operator regions. This simple paattern of hydrogen bonds and hydrophobic interactions therefore accounts for the specificity of phage 434 cro and repressor protein for 434 operator regions. Note that when glutamines 28 and 29 are replaced by any other amino acid, the mutant phages are no longer viable.

23. It is apparent from crystal structures of these protein-DNA complexes that the differential affinities of 434 repressor and cro for the different operator regions are not determined by sequence-specific interactions between amino acid side chains of the recognition helix and base pairs in the major groove of DNA. Instead, they seem to be determined mainly by the ability of the DNA to undergo specific structural changes so that complementary surfaces are formed between the proteins and the DNA. Nonspecific interactions between the DNA sugar-phosphate backbone and the proteins are one important factor in establishing such structural changes. In all complexes studies the protein subunit is anchored across the major groove with extensive contacts along two segment of the sugar-phosphate backbone, one to either side of the groove. Hydrogen bonds between the DNA phosphate groups and peptide backbone NH groups are remarkably prevalent in these contacts.

24. One of these interaction regions involves the loop after the recognition helix, where three main-chain NH groups form hydrogen bonds with phosphatess 9’ and 10’. All residues in this loop, which are outside the HTH motif, contribute to the surface complementarity between the protein and the sugar-phosspahte surfaces of nucleotides 9’ and 10’. These and other nonspecific interactions, which stabilize the appropriate DNA conformation, involve a large number of residues that are distributed along most of the polypeptide chain. Thus the « unit » that is responsable for differential binding to different operator DNA regions is really an entire binding domain, and nearly all the protein-DNA contacts contribute to this specificity.

26. Tata-box binding protein PDBcode: 1cdw R = 1.9 Å R factor = 0.189 The ternary complexes DNA/TBP/TFIIA and DNA/TBP/TFIIB are now available. The superposition gives the following multicomplex structure.

27. Histone octamer

28. Histone tails between DNA gyres

29. Two halves of DNA wrapped around an octamer

30. 12 8 6 RNA polymerase II (Δ4/7) Crystal structure at 2.8Å resolution

31. RNA polymerase II (Δ4/7) Crystal structure at 2.8Å resolution

32. 1. NTP enters into the E site 2. NTP rotates into the A site Four crystal structures of RNA polymerase II transcribing complexes 4. Post-translocation 3. Pre-translocation