High Throughput Cloning and Expression of NESG Targets

1. High Throughput Cloning and Expression of NESG Targets Jan 2006 Dongyan Wang

2. Cloning and Expression Procedures(1) * : Data entry into Excel spreadsheet @ : Enter target set into Platemaster : Steps involving Robot Restriction Digestion Transformation into XL-Gold cells *Design and order primers *Colony screening PCR & gel *PCR& Gel extraction *Miniprep culture Restriction Digestions Digestion cleanup @Miniprep (Archive DNA and GS) Drying and filtration *Ligation Fragments cloned into vectors

3. Cloning and Expression Procedures(2) Fragments cloned into vectors *Run samples on SDS-PAGE gels, stain and de-stain. Transformation into Magik cells @Expression LB culture (Archive GS) Take gel pictures (or scan and upload) and score. MJ9 culture and dilution *Data entry @Verify Archive Upload to Spine IPTG induction Competition analysis and decision making Harvest, sonication, and sample preparation *Transfer to fermentation

4. Work Flow of a Single Process

5. Primers for Target sets -2 weeks Target sequence in FASTA format: >ER84atgtcccgagtctgccaagttactggcaagcgtccggtgaccggtaacaaccgttcccacgcactgaacgcgactaaacgccgtttcctgccgaacctgc actctcaccgtttctgggttgagagcgagaagcgttttgtcaccctgcgc gtatctgctaaaggtatgcgtgtaatcgataaaaaaggcatcgatacagt tctggctgaactgcgtgcccgtggcgaaaagtactaa Copy & Paste Primer seq. output

6. Primer data copied from Primer pri’meris pasted into Excel worksheet: Same data used to order primer synthesis in 96-well format from Operon Primer data parsed into different fields Target data entered into Set Summary Worksheet

7. PCR and purification of target fragments (1) Day 1-2 1 set = 96 targets Gel pic storage 96 pairs of gene-specific primers PCR products separated On 2% agarose gel 96 PCR reactions And Genomic DNA template Results entered into Excel worksheet Comment field:reason/size

8. PCR and purification of target fragments (2) Day 1-2 • Bands of right sizes are manually cut and put into a 96-well block. • Gel slices melted at 55 C. • Automated gel extraction using Qiagen robot.

9. Problems that may arise • Some organism’s genome is GC rich. Requires GC-rich PCR kit and longer elongation times. • No PCR products or wrong size. • Robot malfunctions. Target sequence GC%

10. Restriction Digestions Day 2-3 • 5’ and 3’ restriction endonuclease digestions for directional cloning. • 2 overnight 37 C reactions. Graphic tools for helping locating different RE/Lig wells

11. Cleaning and filtration Day 4 • Automated digestion cleaning up using Qiagen robot. • Lyophilize the plate in speed vacuum till dry. • Resuspend in dH2O. • Purify DNA using 96-well Centri-Sep plate. Explore non Centri-Sep methods

12. Ligation Day 4-5 • Ligation reaction at 16 C overnight with: • Cut and purified target DNA PCR product. • Appropriate precut pET vectors. • T4 DNA ligase. • 65 C 10 min to inactivate the ligase. • Ligation digestion at 37 C for 1 hr. Graphic tools for helping locating different RE/Lig wells

13. Transformation into XL-gold Day 5-6 • Mix XL-gold competent cells with digested ligated DNA on ice. • Heat shock at 42 C 1 min. • Incubate with SOC 37 C 1 hr. • Plate on LB/Amp plates. • Incubate overnight 37 C. 96 LB/Amp plates

14. Result of transformation into XL-gold Day 6 Enter the number of colonies of each target into worksheet

15. Colony screening (1) Day 6-7 • Pick 2 colonies per target, resuspend in water. • PCR reactions with T7 primers, which anneals to vector sequences flanking the inserts. • Run PCR products on 2% agarose gel. • Select clones with right size. • Enter result into Excel worksheets.

16. Colony screening (2) Extra 1-2 days • For the targets with only one or no positive clones, pick more clones from the XL-gold transformation plate. • Repeat colony PCR. • Enter result into Excel worksheets. • Repeat these steps if needed. 192 clones

17. Miniprep culture Day 7-8 • Fill out the Miniprep Setup Excel worksheet. • Inoculate 10 ul of the right construct into LB/Amp. • Shake 37 C overnight. 4 X

18. Miniprep Day 8 • Obtain archiving labels for the DNA and glycerol stock of the target set. • Make duplicate glycerol stock plates of the miniprep culture according to the archive SOP. • Spin to collect cell pellets. • Miniprep using Qiagen robot. • Archive DNA plates according to the archive SOP. Barcode?

19. Transformation into expression cells Day 8-9 • Mix 1 ul of miniprep DNA with Magik competent cells on ice. • Heat shock 42 C 1 min. • Plate on 24-well LB/Amp/Kan/Glucose plates. • Incubate overnight at 37 C. Miniprep DNA 8 X 24-well plates

20. Small scale expressionand inductions (1) Day 9-11 • Inoculate 1 colony from the Magik transformation plate into 0.5 ml LB/Amp/Kan/Glucose. • Shake 6 hr 37 C. • Make glycerol stock plate of the culture according to the archive SOP. • Inoculate 0.5 ml MJ9 media • Shake overnight at 37 C. colonies 2 X

21. Small scale expressionand inductions (2) Day 9-11 • Read OD600 of the overnight MJ9 culture. Select a few wells and dilute 1:10. • Inoculate 2 ml MJ9 with the overnight culture so that the staring OD600 is 0.1 to 0.2.. • Grow at 37 C until OD600 reaches 0.5 to 0.7. • Induce with IPTG • Shake overnight at 17 C. 2 X 8 X

22. Expression proteinsample preparations Day 11 • Spin plates to collect cell pellets. • Add Lysis buffer to resuspend cells and keep on ice. • Sonicate for 40 min. • Save sonicated TOTAL lysate sample (T). • Spin to collect SUPERNATANT sample (S). • Add protein gel loading buffer to the samples. 2 X (T) s + 2 X (S) s = 384 samples

23. SDS-PAGE gels Day 12-13

24. SDS-PAGE gels Day 12-13 • Heat samples at 72 C for 10 min. • Run samples on SDS-PAGE gels. • Wash and stain gels. • De-stain gels. • Take gel pictures/scan. 384 samples 36 SDS-PAGE gels 96-well Ni-NTA plate?

25. Data Management Overview • Analyze SDS-PAGE gels, score expression and solubility. • Enter data into Excel worksheet. • Verify that all the wet reagents are archived. • Upload cloned constructs and small scale expression data into SPiNE. • Perform competition analysis. • Transfer to fermentation.

26. Expression and Solubility Scores Gel picture storage

27. Spine construct upload

28. Spine small scale expression upload

29. Competition analysis Link/Buttons

30. Transfer to Fermentation • Enter into Excel worksheet the targets that satisfy the following criteria: • EXS >=8 • No PDB/PDBH hits or E value >= 0.01. • Other criteria? • Transfer to fermentation

31. Target set statistics

32. Summary of a target’s life in the NESG cloning pipeline

33. Success Data Recorded at Each Step Target sequence Primer data PCR result, gel picture • Ligation well • Ligation date • Transformation colony # Die Step • Well locations & Clone # • Col PCR gelpics • Miniprep well locations • Miniprep culture • Archive locations

34. Data Recorded Success • Expression transformation results • Expression date • Archive locations • SDS-PAGE gel setup • SDS-PAGE gel pictures • Gel scores • Competition analysis results • Fermentation list Die Step

35. It would be nice to have in PLIM • Target data recorded at each working step. • Search by target name. • Statistics of target results. • Graphic tool to help working with 96-well plates. • Notes of problems during the processes • Link to archiving. • Buttons for PDB competition analysis (current e-mail search).