Record Definitions in your notebook:

1. Record Definitions in your notebook: • Somatic Cells  Any cell in a multicellular organism except a sperm or egg cell (gametic cells) • Gametic cells  A haploid cell such as an egg or sperm • Sex-linked trait are inherited genes that do determine an individual’s sex • Autosomal trait are inherited via genes that do not determine an individual’s sex • Exon  a coding region of a eukaryotic gene • Intron  a noncoding, intervening sequence within a eukaryotic gene

3. DO NOW: Record definitions/diagrams in notebooks • Phenotype: the physical and physiological traits of an organism • Karyotype: a method of organizing the chromosomes of a cell in relation to number, size, and type

4. Mutations and Their Significance

5. Sickle Cell Anemia • Normal hemoglobin gene …ACTCCTGAGGAG… • Mutated hemoglobin gene …ACTCCTGTGGAG… • Mutation type _____________________ • Result: Harmful, DNA base is changed, this change substitutes the amino acid valine for glutamic acid. Sickle cell disease is harmful, sometimes fatal. substitution

6. Huntington’s Disease • Normal HAP-1 gene …TACCCGTTACAGGCA… • Mutated HAP-1 gene …TACCCGTTACAGCAGCAGCAGCAGCAGGCA… • Mutation type _____________________ • Result: Harmful, genetic defect on chromosome 4. The defect causes a part of DNA, called a CAG repeat, to occur many more times than it is supposed to. duplication/repeat

7. Resistance to HIV • Normal CKR-5 gene (susceptible to HIV infection) • …CATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAAAG… • Mutated CKR-5 gene (highly resistant to HIV) • …CATTTTCCATACATTAAAG… • Mutation type _____________________ • Result: Beneficial, protects individuals against strains of HIV deletion

8. Cystic Fibrosis • Normal CFTR gene …AGCTAACAGGGG… • Mutated CFTR gene …AGCTAGGGG… • Mutation type _____________________ • Result: Harmful, thick mucus that clogs their lungs and breathing passageways deletion

9. RNA and Protein Synthesis

10. The Structure of RNA • List the three main differences between RNA and DNA. • 1. DNA is double stranded, RNA is single stranded • 2. mRNA is a compliment to the DNA, but it uses uracil (U) instead of thymine (T) • 3. The sugar is RNA is ribose instead of deoxyribose

11. The Structure of RNA • Is the following sentence true or false? RNA carries the genetic message from DNA in the nucleus to the ribosomes in the cytoplasm. True

12. Types of RNA • TypeFunction • _____________ Carries copies of the instructions for assembling amino acids from DNA to the rest of the cell • _____________ Together with proteins forms the structures of ribosomes • _____________ Organelle that functions as the site of protein synthesis in the cytoplasm • _____________ Transfers each amino acid to the ribosome to help assemble proteins

14. Transcription • Which of the following sentences are true about transcription? • 1. RNA Polymerase binds to DNA and separates the DNA strands • 2. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA • 3. Sequences of DNA that are not involved in coding for proteins are introns • 4. The DNA sequences that code for proteins are called exons

15. Transcription • The purpose of transcription is to make a copy of the genetic code contained in the DNA sequence into mRNA which can leave the nucleus • Enzymes copy one strand of DNA into a single-stranded mRNA molecule ( A binds with U, T binds with A, G binds with C)

16. RNA Splicing • Many RNA molecules from eukaryotic genes have sections, called __________, edited out of them before they become functional. The remaining pieces, called __________, are splice together.

17. The Genetic Code • Genes code for polypeptides • DNA triplets (codons) code for one amino acid • Amino acids link together to form polypeptides. • Polypeptide presence or absence determines an organism’s traits

18. The Genetic Code • Proteins are made by joining ___________ into long chains called _______. • RNA contains ____ different bases: _______, ________, _________, ________. • The genetic code is read three letters at a time. Each three letter “word” in mRNA is known as a codon. • A _______ consists of three consecutive nucleotides that specify a single amino acid

19. Translation • mRNA is transcribed in the nucleus, then enters the cytoplasm and attaches to a ribosome • Translation begins at AUG, the start codon. Each tRNA has an anticodon whose bases are complimentary to a codon on the mRNA strand • The ribosome positions the start codon to attract an anticodon, which is the part of tRNA that binds the codon • The ribosome moves along mRNA, binding new tRNA molecules and amino acids

20. COMPONENTS THAT MAKE UP THE GENETIC CODE ARE COMMON TO ALL ORGANISMS • Including, but not limited to: • Universality of code (with some exceptions) • Structure of DNA is similar for most organisms • DNA triplets code for the same amino acids in most organisms

21. Changes in DNA Change in Base Sequence Vs. Chomosome-level changes Insertion Duplication Deletion Deletion Substitution Inversion Frameshift Translocation Point Non-disjunction

22. Changes in Base Sequence • Frameshift • Changes all codons from that point foward

23. Changes in Base Sequence • Point Mutation • No change in amino acid (silent) • Change in a single amino acid • Sickle cell anemia • PKU (Phenylketonuria) • Hemophilia • Color blindness • Huntington’s disease • Tay-Sachs disease • Cystic fibrosis

24. Changes in Base Sequence • Chromosome-level changes • Normal karyotype to abnormal karyotype. • Results of non-disjunction • Down syndrome • Turner syndrome • Klinefelter syndrome • Cri-du-chat syndrome • Some mutations are beneficial to the organism. • CKR5 deficiency (resistance to HIV) • Process of evolution occurs because of changes in traits caused by mutations