1 / 5

Cell differentiation basing on ACTB expression

Cell differentiation basing on ACTB expression. AIM . Detect mouse and human ACTB gene in two co-cultured cell liens Cell Lines: MEF – Mus muscullus embroynic fibroblasts

makoto
Download Presentation

Cell differentiation basing on ACTB expression

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Cell differentiationbasing on ACTB expression

  2. AIM • Detect mouse and human ACTB gene in two co-cultured cell liens Cell Lines: MEF – Musmuscullusembroynic fibroblasts Cells infected with SV40 polyomavirus. LargeT antigen(protein) is believed to bind and limit p53 activity – transcription factor responsible for cell death

  3. AIM • Detect mouse and human ACTB gene in two co-cultured cell liens Cell Lines: BjhTERT – Homo sapiens sapiens fibroblast immortalised with hTERT(human telomere reverse transcriptase)

  4. AGCCTCGCCTTTGCCTTCCTTTTACGACCTCAATGCTGCTGCTGTACTACTCTTCGCCCCGCGAGCACAG TTACACCCTTTCTTTGACAATCCGAGTAGTCTTTGTGCGTCTATTTAGTGGAGCCGCAACTATCTTCTTTGACTGTTACTGAGCTGCGTT Cy3 Cy5 CCTCAATGCTGCTGCTGTACTAC TGCGTCTATTTAGTGGAGCC

  5. No primer given for mouse ACTB padlock. We will use random priming ! (random decamers : 10 bases oligos)

More Related