1 / 43

From Gene to Protein

From Gene to Protein. How Genes Work. What do genes code for?. How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA. DNA. proteins. cells. bodies. The “Central Dogma”. Flow of genetic information in a cell

malo
Download Presentation

From Gene to Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From Gene to Protein How Genes Work

  2. What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

  3. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? RNA DNA protein trait DNA gets all the glory, but proteins do all the work!

  4. A B C D E disease disease disease disease Metabolism taught us about genes • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism Am I just the sum of my proteins? metabolic pathway     enzyme 1 enzyme 2 enzyme 3 enzyme 4

  5. 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

  6. X rays or ultraviolet light Wild-type Neurospora asexual spores Minimal medium Growth on complete medium spores Select one of the spores Grow on complete medium Test on minimal medium to confirm presence of mutation Minimal media supplemented only with… Choline Pyridoxine Riboflavin Minimal control Nucleic acid Arginine Niacin Inositol Folic acid p-Amino benzoic acid Thiamine Beadle & Tatum create mutations positive control negative control mutation identified experimentals amino acidsupplements

  7. aa aa aa aa aa aa aa aa aa aa aa From gene to protein nucleus cytoplasm DNA mRNA protein trait

  8. Transcription fromDNA nucleic acid languagetoRNA nucleic acid language

  9. RNA • ribose sugar • N-bases • ____________________ • ____________________ • ____________________ • ____________________ • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

  10. Transcription • Making mRNA • transcribed DNA strand = ___________________ • untranscribed DNA strand = ________________ • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • __________________________ coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  11. RNA polymerases • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • ______________________ • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

  12. Which gene is read? • ________________________ • binding site before beginning of gene • __________________________________ • binding site for RNA polymerase & transcription factors • ________________________ • binding site far upstream of gene • turns transcription on HIGH

  13. Transcription Factors • Initiation complex • ___________________________________________ • suite of proteins which bind to DNA • hormones? • turn on or off transcription • trigger the binding of RNA polymerase to DNA

  14. RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U 5' 3' A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  15. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • ___________ = the real gene • expressed / coding DNA • ___________ = the junk • inbetween sequence intronscome out! eukaryotic DNA

  16. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • ______________________________ • ______________________________ • edit out introns • ______________________________ ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  17. 1977 | 1993 Discovery of exons/introns Richard Roberts Philip Sharp adenovirus CSHL MIT common cold beta-thalassemia

  18. Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  19. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' Whoa! I think we just brokea biological “rule”! RNA splicing enzymes • _________________ • ________________ • proteins • _________________ • several snRNPs • recognize splice site sequence • cut & paste gene No, not smurfs! “snurps”

  20. Alternative splicing • _______________________________________ • when is an intron not an intron… • different segments treated as exons Starting to gethard to define a gene!

  21. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • ________________________________ • ________________________________

  22. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  23. Translation fromnucleic acid languagetoamino acid language

  24. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  25. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets codon

  26. 1960 | 1968 Cracking the code Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine

  27. 1960 | 1968 Marshall Nirenberg Har Khorana

  28. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” • _______________ • AUG • methionine • _______________ • UGA, UAA, UAG

  29. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  30. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  31. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  32. Loading tRNA • __________________________________________ • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  33. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • _____________________________ • _________________ • _____________ • _____________ E P A

  34. Ribosomes • ____________ (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • ____________(peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • ____________(exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

  35. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

  36. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • ______________________ • _____________________ start of a secretory pathway

  37. Can you tell the story?

  38. 20-30b 5' 3' 5' 3' The Transcriptional unit enhancer exons 1000+b transcriptional unit 3' 5' TAC ACT DNA introns

  39. Bacterial chromosome Proteion Synthesis in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

  40. Prokaryotes _________________ _________________ _________________ _________________ _________________ Eukaryotes _________________ _________________ _________________ _________________ _________________ _________________ intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

  41. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  42. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • RNA processing

  43. Any Questions?? What color would a smurf turnif he held his breath?

More Related