DNA variation in Ecology and Evolution I- Organization of the genome

1. DNA variation in Ecology and EvolutionI- Organization of the genome Maria Eugenia D’Amato BCB 703: Scientific Methodology

2. Aim of the course Understanding the underlying principles and forces that mold genetic variation in organisms • DNA. Organization of the genetic information. • Methodological approaches to the study of genetic variation. Application of molecular markers. • Patterns of genetic variation and inference of underlying processes in natural populations

3. Domestication: an early understanding of transmission of characters. Early Neolithic wild Bronze Age Present day Ovis orientalis Maize

4. Discovery of the mechanisms of inheritance Cross-pollination experiments with peas Gregor Mendel (1822- 1884)

5. Mendelian laws of inheritance Parental genotype GgWw Parental genotype GgWw • Independent assortment • Independent segregation • Dominant-recessive

6. Meiosis 4c 2c 2c 2c c Homologous chromosomes segregate 2 haploid cells with duplicated genetic material Sister chromatides segregate 4 haploid cells

7. Mitosis 2N - Homologous chromosomes 2C Homologous chromosomes duplicate information 4C Sister chromatides separate 2N chromosomes 2C

8. Organization of the genetic information Animal cell Plant cell

9. Nuclear genetic information Condensation of chromatin Human karyotype

10. Molecular structure of DNA 5’ Purines 3’ Pyrimidines H-bond 3’ 5’

11. Discovery of DNA molecular structure James Watson Francis Crick (1928- ) 1916-2004 Nobel Price 1962 Rosalind Franklin 1920-1958 Maurice Wilkins 1916-2004 Nobel Price 1962

12. Nuclear DNA: coding and non-coding sequences • Coding DNA Genes. • Ribosomal and transfer RNA. Satellite DNA Introns Microsatellites Transposon-like elements • Non-coding DNA Regulatory regions Interspersed repetitive DNA

13. Genes: the coding DNA The role of the three types of gene products: mRNA, tRNA, rRNA tRNA Yeast 18S and 5.8 S rRNA

14. Genes: organization of rRNA and tRNA tRNA and rRNA genes are organized in clusters of repeats rDNA repeat unit Ribosomal genes Nucleolus-organizing region in wheat

15. Genes: organization of single copy DNA

16. Proteins and gene families

17. Gene families: concepts Orthologs Homologs Paralogs Identity by descent different function time Identity by descent Similar function Identity by descent

18. Non-coding DNA1. Satellite DNA ATTCATTCGATATAAAAAAACGTATATTA…. • Repeats = 100s -1000s • base pairs • centromeric- telomeric position

19. Non-coding DNA2.Minisatellites and the origin of DNA fingerprinting Locus 1 (GATTTAA)9 (GATTTAA)7 • VNTR, 10-100 bp repeats • Mostly subtelomeric position • Individual identification Sir Alec Jeffreys

20. Non-coding DNA3. Microsatellites • (AC)n, (ACT)n, (AGTA)n, etc • STR, simple sequence repeats stretches of 2-6 bp • Allelic number is high, mutation rate high. • Accurate individual identification. • Use in genome mapping, forensics, population studies, • pedigree reconstruction, etc.

21. Mobile elements.The origin ofinterspersed repetitive DNA • Fragments of DNA that self-propagate within cell genome • Cause mutations • Challenge the central dogma • of molecular biology Barbara McClintock, 1902-1992. Nobel Price 1983

22. Mobile elements: Retrotransposons LTRs • RNA is copied into DNA and inserted elsewhere in the genome • 40% of human genome is composed of retroelements • Propagation similar to retroviral infections (HIV, HTLV, etc) • LINES • SINES (Alu elements) RNA cDNA Target DNA insertion

23. The other genome:mitochondrial DNA • Coding for 13 proteins, 22 tRNA, 2rRNA • Maternally inherited • Higher evolutionary rate than nuclear DNA • Utilized in the study of • microevolutionary processes, phylogenetics, • phylogeography, etc

24. The genetic code • Information coding for aminoacids is carried by codons in DNA and recognized by the anticodons in the tRNA • The genetic code is redundant • Different code for mtDNA, nuclear DNA, clDNA and taxonomic levels.

25. Genetic code: examples Hystidine. Transversion in 3rd position changes to Glutamine 2-fold degeneracy Alanine 4-fold degeneracy Serine is coded by 6 different codons Krill COI Glycine changes to Cysteine Change in 1st position 0-fold degeneracy Q

26. Change in the heritable material Raw material of evolution Source of variation to be affected by evolutionary processes The origin of genetic variation: MUTATIONS Point mutations Gene duplication Chromosomal rearrangements Polyploidization Types

27. Types of mutations • Single point • Insertions • Deletions Synonymous Protein coding genes Non-synonymous Intronic regions Number of repeats in microsatellites Within loci Changes in RNA genes

28. Point mutations Transversions A T Purine- Purine Transitions C G Pyrimidine- Pyrimidine

29. Insertions and deletions • Reading frame changes in protein-coding regions. Asn Arg Leu Ser Arg AAT CGA TTA TCT AGG AAT ACG ATT ATC TAG G.. Single point insertion Asn Thr Ile Ile STOP New reading frame

30. Insertions and deletions Krill ITS-1 CCCCCATCA CCCCC-TCA

31. Chromosomal rearrangements + A B C D E F A B E D C F A B C D E F A B C D G H I D G H I J K J K E F Inversion Fusion Translocation

32. Ploidy: number of single sets of chromosomes in a cell or organism Changes at the ploidy level • Polyploidy is a common speciation processes in plants • Tetraploids: maize, cotton, leek • Hexaploids: wheat, oat. • Octaploids: strawberries, sugar cane.

33. How often do mutations occur? Mutation rate : the number of mutation events per gene per unit of time Mutation rates per generation Per base pair ~10-8 - 10-9 nuclear coding Per gene ~10-6 - 10-5 Per genome ~0.02 - 1 Microsatellites per loci 10-3 - 10-4 HVR human mtDNA 4.3 10-3

34. Molecular clocks A C B • Constant mutation rate • Inference of divergence time time