1 / 19

Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure

Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure. Dimitris Koureas & Vince Smith Natural History Museum London. Jönköping, Sweden October 27-31, 2014. Funding Opportunities. The ephemeral lifecycle of a project. Development phase.

maxwell-rasmussen
Download Presentation

Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Identifying funding and collaboration opportunities to support the Global Names e-Infrastructure Dimitris Koureas & Vince Smith Natural History Museum London Jönköping, Sweden October 27-31, 2014

  2. Funding Opportunities The ephemeral lifecycle of a project Development phase • Project ends • Funding application Maintenance No further funding or gap in funding for development ? • Project starts

  3. Funding Opportunities “…telephones do not crash; power supplies do not fluctuate; and clocks do not halt (in general). Similarly, a computational tool (…) must be reliable across time, itmust be maintained.”1 1RibesD., Finholt T.A. 2007 Proceedings of the third International Conference on e-Social Science

  4. Funding Opportunities Transition from Project Infrastructure Implementation Communal / agreed Persistent Essential Robust & reliable • Discovery • Individualistic • Ephemeral • Optional • Risk taking Adapted from Patterson D. 2013, Tempe, Arizona

  5. Funding Opportunities Shift in the way we approach e-infrastructuresand information resources Dynamic/open process Stable/rigid system Outsourceto and involvethe end user community We need to set up the environment that will enable the community contribution “An infrastructure must be taken as a processinstead of a system.” Koerten, H. & van den Besselaar P. 2013. Sustainable Taxonomic Infrastructures: System or Process?

  6. The current situation Why Global names services are yet not an established and widely used service? Over-ambitious and non-stepwise approach 1 2 Minimum engagement of stakeholders 3 Failed to convince of the value outside the taxonomic domain

  7. Need for a cross-domain approach http://globalnames.org/background: “The Global Names Architecture was developed to help nomenclaturalists, taxonomists and biodiversity informaticians do their jobs better and faster…” Name services will not only benefit taxonomists, will primarily benefit non-taxonomic disciplines We need to frame our efforts in the context of existing urgent societal challenges & reveal the universal scientific value of effective name services This approach is critical for securing long-term support from external partners

  8. Create new knowledge links at large scale Biogeographical data Ecological traits Invasive species Provisioning service data Regulating service data Cultural service data Medicinal properties Technological uses Vernacular name base Clinical research Omics research Biodiversity New drugs Improved productivity Ecosystem services Ethnobiology Genomics Proteomics Metabolomics Parasites & vectors Epidemiological data Animal experimental data

  9. RECONCILIATION GROUP Homotypic synonyms Didymospheniageminata (Lyngbye) Schmidt 1899 Didimospheniageminata Heterotypic synonyms EchinellageminataLyngbye 1819 EchinellageminataLyngbye Scientific names Heterotypicsynonyms Gomphonemageminatum(Lyngbye) C.Agardh 1824 GomphonemavulgareBrébisson 1838 G. vulgareBreb. Vernaculars Rock snot didymo AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTTCTAGAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRCAGAGGATGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTTACGTCGATGAATGTATTAGCATGGAA Surrogates IDs e423b2b9-35b0-4819-8ce9-88e770d368e7

  10. RESOLUTION Homotypic synonyms Didymospheniageminata (Lyngbye) Schmidt 1899 Didymospheniageminata (Lyngbye) Schmidt 1899 Didimospheniageminata Heterotypic synonyms EchinellageminataLyngbye 1819 EchinellageminataLyngbye Scientific names Heterotypicsynonyms Gomphonemageminatum(Lyngbye) C.Agardh 1824 GomphonemavulgareBrébisson 1838 G. vulgareBreb. Vernaculars Rock snot didymo AAAAAGCTCGTAGTTGGATTTGTGATGGAATTTGAATACTTTTAAAGTGTTCTAGAAACTGTCATCCGTGGGTGGAATTTGTTTGGCATTAGGTTGTCAGRCAGAGGATGCCTATMCTTTACTGTGAAAAAATCAGTGCGTTCAAAGCAGACTTACGTCGATGAATGTATTAGCATGGAA Surrogates IDs e423b2b9-35b0-4819-8ce9-88e770d368e7

  11. Opportunities for efficient collaboration Research Data Alliance One of 33 Interest groups of RDA Biodiversity Data Integration IG Status: Recognised & Endorsed Chairs: Yde de Jong, Nicola Nicolson, Vince Smith, Paul Kirk, Dimitris Koureas Currently 53 members: 80% increase in number of members since last RDA plenary (P4) Core group created to support the creation of a Working Group on Global Name services Identified the opportunity to work closely together with TDWG – Joint Working Group? Case statement to be submitted by Feb 2015

  12. Opportunities for efficient collaboration European Strategy Forum on Research Infrastructures (ESFRI) In particular the environmental and health and food clusters Clinical research Omics research Biodiversity In fact we need to find communities as stakeholders/beneficiaries across domains Ecosystem services Ethnobiology

  13. Funding Opportunities A standing programme to enable collaboration and secure long-term funding How would tackle urgent societal challenges? How does it fit in the Big Data technical challenges? Who are the direct and subsequent beneficiaries? Who are the stakeholders and their investment in supporting this? 1 2 3 4

  14. Funding Opportunities An approach to develop a strong funding profile A Minimum Viable Product (MVP) approach – adopt a stepwise strategy 1 Develop a stepwise work programme to achieve the long-term vision 2 Demonstrate impact delivered from every step through lacing together with compelling case studies 3

  15. Funding Opportunities Three routes to choose from: Small or medium sized grants to develop the building blocks of the service 50-100k US and EU Foundations and Research Council grants 1 Large grants from regional funding programmes Horizon 2020 3 2-8m Embed as element in different bigger projects 200-300k 2

  16. Funding Opportunities Supporting the development of a MVP through European e-infrastructure projects

  17. Funding Opportunities Networking platforms COST Actions [EU] e.g. BioUnify (submitted but unsuccessful) Research Coordination Networks (RCN) [US] National funding sources Research councils & foundations

  18. Development phase • Project ends • Funding application Maintenance Hybrid model Anchoring to core funds + Crowdsourcing to beneficiaries • Project starts

  19. Thank you @dimitriskoureas d.koureas@nhm.ac.uk

More Related