DNA and Genes

1. DNA and Genes

2. Thing to find out: • What is DNA? • The Genetic code • The Human genome • Passing on the genomic information • Inheritance patterns

3. Diversity of Life • All biological systems are composed of the same types of molecules • Similar organization priciples are used at the cellular level

4. The Cell • Basic component of life • Two main categories, prokarytic and eukaryotic cells • Differences in the nucleus

5. Prokaryotes lack a defined nucleus and have a simplified internal structure • Eukaryotes have membrane limited nucleus and more complicated internal structure • Three branches of life

6. Genetic material is located to the nucleus • The genetic information is stored in Deoxyribonucleic acid, DNA • DNA contains all the information needed to build an individual

7. What is DNA needed for? • Genetic information • is used for gene expression • Information of a gene is • transferred from DNA and • converted to protein • RNA molecules work as messangers • Proteins are the biological workers

8. Information of the DNA is copied by • directing the synthesis of a RNA molecule • in a process called transcription • RNA directs the protein synthesis in a translation • Protein’s 3D structure determines it’s function • Information can transfer only in one direction

9. DNA (Deoxyribo Nucleic Acid) • DNA is a polymer of nucleotide monomers • 2’-deoxyribose sugar • Four bases: • Adenine, A • Guanine, G • Thymine, T • Cytosine, C Base part • Together a sugar and • a base are called • a nucleoside Sugar part

10. Purine bases Adenine and guanine Two carbon rings Pyrimidine bases Thymine and cytosine A single carbon ring Four bases...

11. DNA chains • Nucleosides are joiden together with phospsodiesteri bond • Sequence of bases vary  genetic information • Chains are extremely long!

12. DNA Molecules • DNA molecules are composed of two polynucleotide chains • Double helix, twisted in right handed way • Twists a full circle in every 10 bases

13. ”ladder-structure” • Bases = steps • Sugars and phosphates = suporting pilars • Two nucleotide chains run in opposite directions  chemical direction

14. Complementary Pairing • Bases interact with other bases • Purines with two carbon rings interact only with single ring pyrimidines  Space between the chains is limited. • A  T • G  C • Complementary pairing  Vital for retainins of the genetic information! • Interaction is stabilized by hydrogen bonds • A-T bond  two hydrogen bonds • G-C bond  three hydrogen bonds

15. The Genetic Code • Describes how base sequences are converted to protein sequence • DNA sequence is divided into series of units of three bases  a codon • One codon is spesific to one amino acid ( structural component of protein)

16. The four bases can form 64 codons • 20 amino acids are found from the nature • Codons hava also alternative functions needed to regulate protein synthesis

17. Right reading frame is obligatory!!! • Sequence of human HCR gene, which assosiates with psoriasis atgtttccac cttcaggttc cactgggctg attcccccct cccactttca agctcggccc ctttcaactc tgccaagaat ggctcccacc tggctctcag acattcccct ggtccaaccc • Many different reading frames can be used, but only one is the right one • Transleate tools can found form the internet Frame 1 Met F P P S G S T G L I P P S H F Q A R P L S T L P R Met A P T W L S D I P L V Q Frame 2 C F H L Q V P L G Stop F P P P T F K L G P F Q L C Q E W L P P G S Q T F P W S N Frame 1 G L D Q G N V Stop E P G G S H S W Q S Stop K G P S L K V G G G N Q P S G T Stop R W K H The right one

18. Genes • Genetic information is encoded in the base sequence of the DNA • A gene : DNA sequence that encodes amino acid sequence of a protein • Beside the coding area, also other elements are needed  control elements and ”empty areas”

19. Genes vary a lot in size • Genes are separeted from each others by sequences which function is unknown • Only other strand of the DNA carries biological information  template strand • Potential to store biological information is enormous

20. Chromosome Condenced scaffold fibers connected to chromosome scaffold chromatin fibers chromatin DNA

21. Mutations • Mutations are alterations in DNA sequence • Many chemical and physiological agents • and errors in DNA replication • Cells can repaire some mistakes • Once introduced and not repaired, • changes in DNA sequence are • made permanent by DNA replication

22. Sequence variations: Single nucleotide polymorphims: Alteration of a single base  1. Causes an alteration in the amino acid that the codon codes 2. Does not cause alteration on the amino acid that the codon codes 3. Alters codon in the way that it becomes stop-codon for protein synthesis

23. Frameshift mutation: insertion/deletion of bases  reading frame is alterered

24. The Human Genome The different types of sequences that make up the total DNA of a human cell

25. The Human genome... • 3 billion base pairs • about 30000 genes • 23 chromosome pares  46 chromosomes • 25 % of the DNA is gene related • Only 5 % encodes proteins • Genes include exons and introns • Beside coding areas also additional secuences are found

26. Two important terms... Phenotype: The outlook of an organism Genotype: The genetic information written in the DNA Phenotypes Genotype Genotype GCCAAGAATGGCTCCCACCT GGCTCTCAGACATTCCCCTGGTCCAACCCCCAGGCCATCAAGATGTCTCAGAGAGGCGGCTAGACACCCAGAGACCTCAAGTGACCATGTGGGAACGGGATGTTTCCAGTGACAGGCA ATGTTTCCACCTTCAGGTTCC ACTGGGCTGATTCCCCCCTCC CACTTTCAAGCTCGGCCCCTT TCAACTCAGAGAGGCGGCTA GACACCCAGAGACCTCAAGT GACCATGTGGGAACGGGATG TTTCCAGTGACAGGCAG

27. Passing on the genetic information: • Information passed on in the sexual reproduction • Needed for new characteristics to develope

28. All somatic cells • 46 chromosomes • Diploid cells, 2n Fertilization: + n n • Sperm cell • 23 chromosomes • Haploid cell, n • Egg cell • 23 chromosomes • Haploid cell, n • Fertilized egg • 2n • 46 chromosomes

29. Mitosis • Every cell division • The number of chromosomes • does not change • DNA dublicates before entering • the mitosis • Takes 1-2 hours

30. Meiosis • Nuclear division • Only in gamete formation • Results formation of the haploid • gametosytes • Mature gametocytes have 23 • chromosomes (n)

32. Humans • 46 chromosomes ( 44 autosomes, 2 sex chromosomes) • X and Y –chromosomes • XX  female • XY  Male

35. The chromosome pare: • A locus • An allele • Heterozygous (Aa) • Homozygous (AA or aa)

36. We have two copies of each gene, one from the mother • and one from the father  Genotype • Dominant character: only one allele needed to cause the • phenotype (heterozygous) • Recessive character: both allels needed to cause the • phenotype (homozygous)

37. Inherited diseases • DNA mutations are significant in development of diseases • Inherited diseases are caused by mutations passed from • a parent to a offspring • Monogenic diseases: disease is caused by mutation in • one gene • Multifactioria diseases: disease is caused by co-operative • action of different mutations in different genes and • environmental factors • Mendelian inheritance: Presence or absence depends of the genotype at the single locus

39. Autosomal dominant inheritance:

40. Autosomal recessive inheritance:

41. X-chromosome linked recessive inheritance:

42. X-chromosome linked dominant inheritance: