1 / 61

From Gene to Protein

From Gene to Protein. How Genes Work. A. B. C. D. E. disease. disease. disease. disease. Metabolism taught us about genes. Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme

mesta
Download Presentation

From Gene to Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From Gene to Protein How Genes Work

  2. A B C D E disease disease disease disease Metabolism taught us about genes • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism Am I just the sum of my proteins? metabolic pathway     enzyme 1 enzyme 2 enzyme 3 enzyme 4

  3. PKUphenylketonuria alkaptonuria tyrosinosis albinism cretinism ingested protein digestion phenylalanine phenylalanine hydroxylase melanin tyrosine thyroxine transaminase hydroxyphenylpyruvicacid hydroxyphenylpyruvic acidoxidase homogentisicacid homogentisic acidoxidase maleylacetoaceticacid CO2 & H2O

  4. 1 gene – 1 enzyme hypothesis • Beadle & Tatum • Compared mutants of bread mold, Neurospora fungus • created mutations by X-ray treatments • X-rays break DNA • damage a gene • wild type grows on minimal media • sugars + required nutrients allows fungus to synthesize essential amino acids • mutants require added amino acids • each type of mutant lacks a certain enzyme needed to produce a certain amino acid • non-functional enzyme from damaged gene

  5. X rays or ultraviolet light Wild-type Neurospora asexual spores Minimal medium Growth on complete medium spores Select one of the spores Grow on complete medium Test on minimal medium to confirm presence of mutation Minimal media supplemented only with… Choline Pyridoxine Riboflavin Minimal control Nucleic acid Arginine Niacin Inositol Folic acid p-Amino benzoic acid Thiamine Beadle & Tatum create mutations positive control negative control mutation identified experimentals amino acidsupplements

  6. One gene / one enzyme hypothesis • Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E arg-H arg-G arg-F encoded enzyme enzyme E enzyme F enzyme G enzyme H glutamate ornithine citruline arginine argino- succinate gene thatwas damaged substrate in biochemical pathway

  7. 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

  8. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication

  9. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

  10. Transcription fromDNA nucleic acid languagetoRNA nucleic acid language

  11. Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  12. Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

  13. Transcription in Prokaryotes • Initiation • RNA polymerase binds to promoter sequence on DNA Role of promoter • Starting point • where to start reading • start of gene • Template strand • which strand to read • Direction on DNA • always read DNA 35 • build RNA 53

  14. Transcription in Prokaryotes • Promoter sequences enzymesubunit RNA polymerase read DNA 35 bacterial DNA Promoter TTGACA TATAAT –35 sequence –10 sequence RNA polymerase molecules bound to bacterial DNA RNA polymerase

  15. Transcription in Prokaryotes • Elongation • RNA polymerase copies DNA as it unwinds • ~20 base pairs at a time • 300-500 bases in gene • builds RNA 53 Simple proofreading • 1 error/105 bases • make many mRNAs • mRNA has short life • not worth editing! reads DNA 35

  16. Transcription in Prokaryotes • Termination • RNA polymerase stops at termination sequence

  17. Transcription in Eukaryotes Transcription RNA Processing Psssst…DNA can’tleave nucleus! Translation Protein

  18. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

  19. Transcription in Eukaryotes • 3 RNA polymerase enzymes • RNA polymerase 1 • transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • transcribes tRNA genes • each has a specific promoter sequence it recognizes

  20. Transcription in Eukaryotes • Initiation complex • transcription factors bind to promoter region upstream of gene • suite of proteins which bind to DNA • turn on or off transcription • TATA box binding site • recognition site for transcription factors • transcription factors trigger the binding of RNA polymerase to DNA

  21. Protecting RNA – Posttranscriptional modification • 5’ cap added • G trinucleoside (G-P-P-P) • protects mRNA • from RNase (hydrolytic enzymes) • 3’ poly-A tail added • 50-250 A’s • protects mRNA • from RNase (hydrolytic enzymes) • helps export of RNA from nucleus UTR UTR

  22. “AVERAGE”… “gene” = 8000b pre-mRNA = 8000b mature mRNA = 1200b protein = 400aa lotsa “JUNK”! Dicing & splicing mRNA • Pre-mRNA  mRNA • edit out introns • intervening sequences • splice together exons • expressed sequences • In eukaryotes: • 90% or more of gene can be intron

  23. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' Splicing enzymes • snRNPs • small nuclear RNA • proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste No, not smurfs! “snurps”

  24. 1982 | 1989 Ribozyme • RNA as ribozyme • some mRNA can even splice itself • RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado

  25. Hard to definea gene! Alternative splicing • Alternative mRNAs produced from same gene • when is an intron not an intron… • different segments treated as exons

  26. Domains • Modular architectureof many proteins • separate functional & structural regions • coded by different exons in same “gene”

  27. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Summary of Post-transcriptional processing • Primary transcript (pre-mRNA) • eukaryotic mRNA needs work after transcription • mRNA processing (making mature mRNA) • mRNA splicing = edit out introns • protect mRNA from enzymes in cytoplasm • add 5 cap • add polyA tail 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  28. Splicing details • No room for mistakes! • editing & splicing must be exactly accurate • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  29. gene RNA polypeptide 1 gene polypeptide 2 polypeptide 3 Defining a gene… “Defining a gene is problematic because… one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there are many other complications.” – Elizabeth Pennisi, Science 2003 It’s hard to hunt for wabbits, if you don’t knowwhat a wabbitlooks like.

  30. Translation fromnucleic acid languagetoamino acid language

  31. Making proteins – organelle review • Organelles • nucleus • ribosomes • endoplasmic reticulum (ER) • Golgi apparatus • vesicles small ribosomal subunit nuclear pore mRNA large ribosomal subunit cytoplasm

  32. Nucleus & Nucleolus

  33. large subunit small subunit ribosome Nucleolus • Function • ribosome production • build ribosome subunits from rRNA & proteins • exit through nuclear pores to cytoplasm & combine to form functional ribosomes rRNA & proteins nucleolus

  34. large subunit small subunit 0.08mm Ribosomes Rough ER Smooth ER Ribosomes • Function • protein production • Structure • rRNA & protein • 2 subunits combine

  35. The "S" stands for svedbergs, a unit used to measure how fast molecules move in a centrifuge. • Some antibiotics (tetracycline and streptomycin) inactivate bacterial ribosomes

  36. Types of Ribosomes • Freeribosomes • suspended in cytosol • synthesize proteins that function in cytosol • Bound ribosomes • attached to endoplasmic reticulum • synthesize proteins for export or for membranes membrane proteins

  37. TO: TO: TO: TO: endoplasmicreticulum nucleus proteinon its way! DNA RNA vesicle vesicle ribosomes TO: protein finishedprotein Golgi apparatus Making Proteins

  38. Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst…no nucleus! protein Cell membrane Cell wall

  39. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  40. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • RNA processing

  41. Translation in Eukaryotes

  42. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  43. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

  44. 1960 | 1968 Cracking the code Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine (phe)

  45. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  46. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA aminoacid anti-codon

  47. Transfer RNA structure (45 different tRNAs) • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  48. Loading tRNA • Aminoacyl tRNA synthetase (20 – 1 for each aa) • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • energy stored in tRNA-amino acid bond • unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  49. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  50. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

More Related