1 / 47

DNA

Explore the fascinating world of DNA and learn about its structure, replication, transcription, translation, and different types of mutations. Understand the importance of DNA in our growth and development.

monicamiller
Download Presentation

DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA 2012-2013

  2. Organic Compounds • Any compound that contains BOTH Carbon (C) and (H) • Methane CH4 • Glucose C6H12O6

  3. Organic Compounds for Metabolism • Carbohydrates • Lipids • Proteins • Nucleic Acids

  4. Carbohydrates and Lipids • Carbohydrates • Provide Energy • Contain C, H, O in a 1:2:1 ratio • C6H12O6 • C5H10O5 • Lipids • Store Energy • Contain C, H, O; but have less Oxygen than Carbohydrates

  5. Proteins and Nucleic Acids • Proteins • Important for body-building material (muscles) • Made from Amino Acids • Contain C, H, O, and N • Nucleic Acids • Helps to store cellular information • Includes DNA and RNA • Contain C, H, O, N, and P

  6. DNAThe Blue Print of Life DeoxyriboNucleicAcid Contains the genetic information used for our growth and development Credit for structure is given to Watson and Crick.

  7. What DNA is Composed Of DNA is made up of Nucleotides Double stranded Each nucleotide has: A 5-carbon sugar: Deoxyribose A phosphate A nitrogen base

  8. The Nitrogen Bases • The four Bases of DNA are: • Adenine (A) • Thymine (T) • Cytosine (C) • Guanine (G) • The base pairing are: • Adenine with Thymine • Cytosine with Guanine

  9. Purines and Pyrimidines Purines: 1 ring Adenine (A) Guanine (G) Pyrimidines: 2 rings Thymine (T) Cytosine (C) Purines can only pair with Pyrimidines

  10. Structure of DNA Structure Two strands twisted together (helix) Sides of Ladder Alternating Phosphate and Sugar Rungs of Ladder Pair of nucleotide bases

  11. Replication • Replication is the process of duplicating DNA • Two identical copies of DNA result • The process occurs: • in the nucleus • During the s-phase of the cell cycle

  12. Replication Process • DNA Helicase unzips the double helix • Free-floating nucleotides from within the nucleus “repair” each side • Two new and identical structures result • Complimentary (original strand) • Template (newly formed strand)

  13. Replication Practice • Where does replication take place? • During what phase of the cell cycle? • Practice: • Template: ATTGCAGGCCTTAGTCAC • Replicate:

  14. More Practice AGTTCAGCGGTATTAGCTAGCAACCGT

  15. RNA • RiboNucleicAcid • RNA is made of nucleotides • Single stranded • Each nucleotide has • 5-carbon sugar; Ribose • Phosphate group • Nitrogen Base

  16. The RNA Bases • The four bases of RNA are: • Adenine • Uracil • Cytosine • Guanine • The base pairs are • Adenine and Uracil • Cytosine and Guanine

  17. Comparing DNA and RNA

  18. Types of RNA Three Types: mRNA: (messenger) Takes code from DNA in nucleus to ribosome tRNA: (transfer) Brings amino acids to the ribosome to build proteins rRNA: (ribosomal) Makes up ribosomes

  19. Transcription RNA polymerase unzips the DNA structure Free-floating RNA nucleotides repair ONE SIDE of the structure The new mRNA strand leaves the nucleus to go to a ribosome in the cytoplasm

  20. Transcription Practice DNA strand: ATACTGTCAGTATGGCCAT RNA strand: Practice problem: TATTACGACCCGTACTAGAATG

  21. Reverse Transcription DNA strand: RNA strand: UAGGCUACUGAUCCAAUG

  22. Proteins • There are 20 different amino acids that join together to make proteins • The amino acids are joined by peptide bonds AA + AA + AA + AA = Protein

  23. Codons • Codons are groups of three nitrogen bases • They signal for specific amino acids • CUC (Leucine) • ACC (Threonine) • Some codons start or stop protein synthesis • AUG (Start) • UAA (Stop) • UAG (Stop) • UGA (Stop)

  24. Facts About Translation • It is also called Protein Synthesis • It occurs • At a ribosome • In the cytoplasm

  25. Translation (Protein Synthesis) • mRNA breaks into codons and signals specific amino acids • tRNA brings the amino acid to the ribosome • Each amino acid bonds to another to form a protein

  26. Transcription and Translation

  27. Translation Practice mRNA: AUG AGC UGG GGG UAU UAG Amino acid: Met Ser Leu Gly Tyr Stop Practice mRNA: AUG UGU AGC CCU AUU UAA tRNA: Amino acid:

  28. Central Dogma of Protein Synthesis

  29. Mutation Mutations any changes to either DNA or RNA. Causes: copying errors in the DNA during mitosis and by exposure to ultraviolet radiation, xrays, radioactivity, or viruses. Results: genetic disorders, death, or have no affect. Most mutations are repaired by enzymes.

  30. Chromosome Insertion Deletion Translocation Substitution Nondisjunction Gene Point Frameshift Mutations

  31. Insertion Insertion: the addition of one or more nucleotide base pairs into a genetic sequence Ex: Normal: AAACCCGGG Mutated: AAACACCGGG

  32. Deletion Deletion: part of a chromosome or a sequence of DNA is missing. Any number of nucleotides can be deleted, from a single base to an entire piece of chromosome. Example Normal: AAACCCGGG Mutated: AAACCGGG

  33. Substitution Substitution: one or more nucleotides are substituted by the same number of different nucleotides.  In most cases, only one nucleotide is changed. Example: Normal: AAACCCGGG Mutated: AAACACGGG

  34. Gene Mutations Frame-shift mutation: causes a change all the way down a DNA sequence, making each codon a different sequence. (MORE SERIOUS!) EX. CAG TTC CTG GAA -> (frameshift)-> CAG TTA CCT GGA Insertion Deletion Point-shift mutation: a single letter is the only thing changed in the DNA sequence EX. GTA CTG CAA-----> (point mutation) -----> GTA GTG CAA Substitution

  35. Viruses

  36. Virus Virus is a tiny non-living particle that enters and then reproduces inside a living host cell.

  37. Characteristics of Viruses • Have either DNA or RNA. • May be single stranded or double stranded. • Nonliving because cannot: • make food • take in food • use energy • respond to stimuli • make waste • multiply on their own. • A Bacteriophage is a virus that infects bacteria.

  38. Virus Shape and Size Viruses are smaller than bacteria (measured in nanometers) Structure: (2 main Parts) Protein Coat Inner Genetic Material (DNA or RNA)

  39. Virus Shapes and Sizes

  40. Lytic Cycle: Lytic Cycle: Virus enters cell and uses cell to reproduce. (Ex. Flu, Rhinovirus) Viral DNA destroys Cell DNA, takes over cell functions and destroys the cell. The Virus replicates. There are symptoms of viral infection. Active viral infection takes place.

  41. Lysogenic Cycle Lysogenic Cycle: Virus enters cell and becomes part of cells DNA. May enter lytic cycle if exposed to stress. (Herpes, cold sores.) Viral DNA merges with Cell DNA and does not destroy the cell. There are no symptoms of viral infection. Passive viral replication takes place.

  42. Lysogenic/Lytic Cycle

  43. Lytic VS Lysogenic Cycle

  44. Ways to Protect Vaccinations: weakened or dead viruses injected into the body to stimulate immune response. (Antibodies form against virus) Proper hygiene/hand washing Minimize risk by avoiding risky behavior. (ex. IV drug use, unprotected sex)

  45. Cancer Some viruses have been linked to the formation of tumors. HPV linked to cervical cancer Hepatitis B and C linked to liver cancer Epstein-Barr linked to lymphoma

More Related