Warm Up Answers

1. Warm Up Answers • What is cancer? Disease caused primarily by uncontrolled cell growth. This growth results in tumors, which are masses of cells that lack proper function. • What is the difference between malignant and benign tumors? Sometimes tumors form in areas of the body where it generally doesn’t cause any secondary issues. These are benign tumors and are relatively easy to take care of. Malignant tumors, on the other hand, are tumors that grow in tissue or organs and lead to secondary issue and sometimes death. • Think about this. Your hair color is made possible by you inheriting the gene from your parents. Genes are contained in DNA, written as a specific sequence of nucleotides (A, T, C, G). If the “spelling” of the gene in DNA was changed somehow (lets say TAC TGC  TAC TTC), what would be the most immediate, specific consequence? Changes in mRNA. • & What would be the ultimate issue that might result from this type of change in DNA? DNA (gene)mRNAprotein (trait). If DNA is changed then it might result in changes in the protein (trait)

2. Source of Genetic Variation & Genetic Disorders Mutations

3. Exercise Write down the word CASH. How many more words can you make from that word by substituting, adding, or subtracting only one letter with a different letter? • What if the directions asked you to change one letter out of these new words you’ve created… • Then asked you to do this again, and again, (maybe 10 times per new word). In addition, every once in awhile you were allowed to rearrange the letters. • How many new words do you think you could have? • If CASH was a gene, the new words you wrote would be mutations of CASH -Bash • Mash • Dash • Gash • Hash • Lash • Nash • Rash • Sash • Wash • Cast • Case • Casa • Cask • Casi • Crash • Clash • Ash

4. What do you know? • When I say mutant, what do you think of?

7. Mutants among us? • We equate the word mutation with comic book heroes but it’s more than that in reality. • What are “mutants”? • What happens to change typical traits into something new, • Sometimes amazing or • Sometimes ineffective?

8. Objectives: Mutations • Identify the primary mechanism for genetic change and differences among organisms. • List the kinds of mutations. • Describe the characteristics of each mutation. • Identify a mutation present in given DNA strands. Vocabulary • Mutation • Point mutation • Insertion mutation • Deletion mutation • Silent mutation • Missense mutation • Frameshift mutation • Nonsense mutation • Duplication mutation • Inversion mutation • Translocation mutation • Gene rearrangement

9. The Role of Mutations • Mutation is a fundamental and inevitable aspect of heredity. • Without it we would never see new traits… called genetic diversity. Mutations Cro-magnon  Homo Sapien

10. Three Outcomes of Mutations…Some Facts… • Can have no impact and may not be detectable. • These have no effect and are lost in the dominant – recessive allele interaction. • Carriers of some mutations don’t know they have them & don’t display as a physical trait. • A very small percentage can be good, or advantageous, and make life easier or better • These are how it’s believed species evolve. • Most mutations that are detected are so because they are deleterious…meaning they result in something bad & many times death. • These are still very low in number.

11. Mutation: The Basis of Genetic Change • In genetics, a mutation is a change in the structure or amount of the genetic material of an organism. • What is this “genetic material”? = DNA • So: Mutation = change in DNA. • A genetic mutant is an individual whose DNA or chromosomes differ from some original, previous, or normal state. • Don’t be alarmed… • FACT: WE ARE ALL MUTANTS OF SOME SORT.

12. Mutation: The Source of Genetic Change • Mutation has had a profound affect on life. • For the most part, mutations are the source of GENETIC VARIATION among the same and different species. • Variation is the differences, sometimes subtle, observed between organisms of the same and different species. • Genetic variation is also, technically, the course of genetic issues; disorders and sometimes cancer. • As it is, every unique version of every gene (or every gene for that matter) began as a mutation of some original gene.

13. Several Kinds of Mutations • DNA and chromosomes are involved in many processes, so there are many kinds of mutations. • Most mutations involve a misplacement of a SINGLE nucleotide in a DNA segment. • A mutation may change the results of a gene (when the gene is translated and transcribed), but not all mutations do so. • Different kinds of mutations are recognized as either changes in DNA or changes in the results of genes.

14. Several Kinds of Mutations Mutations as Changes in DNA • During DNA replication, the wrong nucleotide may be paired or placed in a sequence. 1. Point mutation: • A point mutation is a change of a single nucleotide in a sequence from one kind of base to another. • POINT: TAC TGC ATG  TAC TGA ATG 2. Insertion or Deletion: • Rarely, mutations can cause the insertion (adding) or deletion (removing) of one or more nucleotides in a sequence. • The CASH exercise we just performed illustrates what results from these types. • INSERTION: TAC TGC ATG  TAC ATG CAT G • DELETION: TAC TGC ATG  TAC _GC ATG…

15. Several Kinds of Mutations Mutations as Changes in Results of Genes • Changes in a DNA sequence may affect the results of genes in many ways. 1. Silent Mutation: • A mutation is silent when it has no effect on a gene’s function because it makes the same amino acid sequence. • SILENT: DNA TAC TGC ATG  TAC TGT ATG • mRNA AUG ACG UAC  AUG ACA UAC • AA met thrtyr  met thrtyr • Point mutations are often silent because the genetic code is redundant • (some amino acids have multiple codons).

16. Several Kinds of Mutations 2. Missence (Replacement) Mutation: • Results when a codon is changed (bases are switched) such that the new codon codes for a different amino acid. • MISSENCE: DNA TAC TGC ATG  TAC CGC ATG • mRNA AUG ACG CUA  AUG GCG UAC • AA met thrtyr met alatyr

17. Several Kinds of Mutations 3. Nonsense: • Results when an internal codon is changed to a “stop” signal. • In this case, the resulting string of amino acids may be cut short, and the protein may fail to function. NONSENSE : DNA TAC TGC ATG  TAC TGC ATT • mRNA AUG ACG UAC AUG ACG UAA • AA met thrtyr  met thrSTOP …

18. Several Kinds of Mutations 4. Frameshift: • The reading frame of a sequence is the original sequence from the start to the end of the gene. • The reading frame depends on the starting point for reading (the start codon). • This sets up the rest of the gene’s codons. • An insertion or deletion can shift the reading frame, or cause a frameshift. • In frameshift mutations, the remaining sequence may be “read” as different codons. FRAMESHIFT: DNA TAC TGC ATG  TAC ATG CAT G • mRNA AUG ACG UAC AUG UAC GUA C • AA met thrtyr  met tyrval …

20. Chromosomal Mutations Sometimes mutations result in large scale changes in the arrangement of genes in chromosomes. Chromosomal Mutations • In eukaryotic cells, various affects creates the chance of large-scale mutations in the arrangement and availability of genes at the chromosomal level. • There are 5 main types of chromosomal mutations.

21. Chromosomal Mutations Chromosomal Mutations • A deletion occurs when a piece of a chromosome is lost. For example: At the end of meiosis, one of the cells will lack the genes from that missing piece. Such deletions are usually harmful. 2. A duplicationoccurs when a piece remains attached to its homologous chromosome after meiosis. One chromosome will then carry both alleles for each of the genes in that piece.

22. Chromosomal Mutations Chromosomal Mutations 3. Aninversionoccurs when a piece reattaches to its original chromosome, but in a reverse direction. 4. A translocation occurs when a chromosome piece ends up in a completely different, non-homologous chromosome. 5. A gene rearrangementcan move an entire gene to a new location. Such a chromosomal mutation is likely to disrupt the gene’s function in other ways.

23. Chromosomal Mutations

24. Most proteins can function normally with only one amino acid change. • The more amino acids changed, the more of an affect on the trait. What is the WORST? No affect Little affect • What is the worst? • Remember: Structure determines function • Tough to say as each scenario is unique, however, the more bases changed in the gene will have more of an impact on the amino acids in the trait. Major Affects

25. What Causes Mutations? • A variety of factors influence changes in DNA. • Harmful environmental agents. • Natural or Synthetic Chemicals: a.k.a. Carcinogens • Ionizing radiation: X-rays and gamma rays can break chromosome pieces or cause free-radicals (highly reactive hydroxide ions that damage DNA) • Non-ionizing Radiation: cause adjacent thymine bases to bond, kinking DNA • Problems in Meiosis • Nondisjunction & Polyploidy • Transposable elements. • Jumping Genes that move from chromosome to chromosome. • Spontaneous errors in replication. • Usually corrected by DNA Polymerase but can, at times, be passed down to next-generation cells. If this happens in gametes, children can be affected with gene-based abnormalities.

26. Transposable Elements Nobel Prize winner in 1983, Barbara McClintock discovered that certain genes can slip from one place on a chromosome to another, sometimes disrupting the target site.

27. Errors In Replication Do you notice where the error is? What would be the type and a possible result?

28. Environmental Influences • http://www.cancer.org/cancer/cancercauses/othercarcinogens/generalinformationaboutcarcinogens/known-and-probable-human-carcinogens • Ionizing Radiation: • Non-Ionizing Radiation: • Carcinogens:

29. What Kind of Mutation Illustrated?In your groups, first identify the problem, make the mRNA, the amino acids, then name the type of mutation. You have 5 minutes for discussion and conclusions. Normal = Wildtype Gene Problem T A C G G A A G C T A C G G T A G C Problem Problem T A C G T T A G C T A C C G G T A G C

30. Each of the following is a modification of the sentence THECATATETHERAT • THERATATETHECAT • THEKATATETHERAT • THETACATETHERAT • THECATARETHERAT • THECATATTHERATS • HECATATETHERATS Which one(s) is/are: • A FRAMESHIFT mutation? • A SILENT mutation? • A DELETION mutation? • An INVERSION mutation? • A POINT mutation?

31. ORIGINAL: THECATATETHERAT • THERATATETHECAT Frameshift Silent Deletion Inversion Point • THEKATATETHERAT Frameshift Silent Deletion Inversion Point • THETACATETHERAT Frameshift Silent Deletion Inversion Point • THECATARETHERAT Frameshift Silent Deletion Inversion Point • THECATATTHERATS Frameshift Silent Deletion Inversion Point • HECATATETHERATS Frameshift Silent Deletion Inversion Point

32. Mutation Detection (25pts) • You, as a microbiologist or a geneticist, have the ability to look at the sequence of an organism. You would do so to detect differences between “normal” DNA and mutations. • Your research objective today is to study the following mutant DNA sequences to detect the type of mutation and where it takes place. The mutations are changes in the DNA that result in the changes of their genes (not their pants). First study the given DNA sequence. Then you will need to determine the reading frame (the active gene within) and transcribe it into mRNA (remember, the mRNA has the codons). Translate the mRNA into a polypeptide so you know the original gene product. Next determine what type of mutation the mutants are by comparing the original DNA strand and the mutant DNA. You will need to use a codon chart (pg307) for help. MIND THE START & STOP CODONS!!!

33. Mutation Detection • Original “given” DNA sequence GGCTACGAGCTTCGAAATTTGCCGATCCCA • (5 pts) First identify the start sequence in the DNA above. Transcribe the DNA into mRNA & group into 3’s until you reach the stop codon. Use the codon chart on pg 307 to identify any changes in amino acids. Translate the mRNA into a polypeptide chain. Use this to compare to the mutants. • Mutant one: Mutation type? (3) Where? (1) Give support! (1) GGCTACGAGCTTCGAAAATTTGCCGATCCCA

34. Mutation Detection • Original “given” DNA sequence GGC[TAC]GAGCTTCGAAATTTGCCGATCCCA mRNA: AUG CUC GAA GCU UUA AAC GGC Stop Polypeptide: Met Leu Glu Ala Leu AsP Gly Stop • (5 pts) First identify the start sequence in the DNA above. Transcribe the DNA into mRNA & group into 3’s until you reach the stop codon. Use the codon chart on pg 307 to identify any changes in amino acids. Translate the mRNA into a polypeptide chain. Use this to compare to the mutants. • Mutant one: Mutation type? (3) Where? (1) Give support! (1) GGCTACGAGCTTCGAAAATTTGCCGATCCCA Mutant one: FRAMESHIFTthe original reading frame is affectedGGCTACGAGCTTCGAAAATTTGCCGATCCCA… AUG CUC GAA GCU UU[U] AAA CGG CUA GGG U mRNA: AUG CUC GAA GCU UUA AAC GGC Stop ORIGINAL Polypeptide:Met Leu Glu Ala Leu Asp Gly Stop ORIGINAL New: Met Leu Glu Ala Phe Lys Arg Leu Gly… The new polypeptide will be MUCH bigger than the original creating a very new gene product…one that most likely won’t be a useable protein.

35. Mutation Detection • Original “given” DNA sequence GGCTACGAGCTTCGAAATTTGCCGATCCCA GGC[TACGAGCTTCGAAATTTGCCGATC]CCA AUG CUC GAA GCU UUA AAC GGC Stop • (5 pts) First identify the start sequence in the DNA above. Transcribe the DNA into mRNA & group into 3’s until you reach the stop codon. Use the codon chart on pg 307 to identify any changes in amino acids. Translate the mRNA into a polypeptide chain. Use this to compare to the mutants. • Mutant one: Mutation type? (3) Where? (1) Give support! (what is the change in the amino acid sequence…1) GGCTACGAGCTTCGAAAATTTGCCGATCCCA Homework (5 points each) • Mutant 2: Mutation type? Where? Give support! GGCTACGAGCTTCGAACTTTGCCGATCCCA • Mutant 3: Mutation type? Where? Give support! GGCTACGAGCCTCGAAATTTGCCGATCCCA • Mutant 4: Mutation type? Where? Give support! GGCTACGACCTTCGAAATTTGCCGATCCCA

36. Mutation Detection: Answers • Original DNA sequence • GGC[TACGAGCTTCGAAATTTGCCGATC]CCA • mRNA:AUG – CUC – GAA – GCU – UUA – AAC – GGC – UAG • A.A.s MET – LEU – GLU – ALA - LEU – ASP – GLY – STOP • Identify the reading frame by transcribing the DNA & identifying the start codon. Then group the codons in 3’s until you reach the stop codon. • Mutant one: FRAMESHIFTthe original reading frame is affectedGGCTACGAGCTTCGAAAATTTGCCGATCCCA… Homework • Mutant 2: NONSENSEan internal stop codon is inserted GGCTACGAGCTTCGAACTTTGCCGATCCCA • Mutant 3: MISSENSE a new amino acid is made with the mutationGGCTACGAGCCTCGAAATTTGCCGATCCCA • Mutant 4: SILENT the gene isn’t affected as GAC & GAG both code for the same amino acidGGCTACGACCTTCGAAATTTGCCGATCCCA UUU – AAA – CGG – CUA – GGG  no end? MET – LEU – GLU – ALA – PHE – LYS – ARG – LEU – GLY  no end? MET – LEU – GLU – ALA – STOP MET – LEU – GLU – ALA – GLU  GLY MET – LEU – GLU – ALA – LEU  LEU

37. Sickle Cell Anemia Research This! Independent Practice • Complete the packet, independently or in small groups no larger than 4. • There are 3 question sets that will require additional research. • #7. Look up the difference between somatic (body cells) and germ (reproductive) cells in a book in class. • #9. Sickle-cell anemia (top). This disease influences the shape of RBCs from round to cylinders. This affects how well they flow through the bloodstream. • #12. Cystic Fibrosis (bottom). This disease causes a build-up of mucus around cells, interfering with respiratory and digestive systems. Cystic Fibrosis

38. Assignment Rubric

39. An Affect of Mutation • Do you know what sickle cell anemia is? • Do you know of someone afflicted? • Can you describe the significant symptoms of this disease?

40. Sickle cell anemia • These are RBC’s • They transport 02 in your bloodstream to cells that need it (for aerobic respiration) • The abnormal cell is a sickle cell. • It isn’t nearly as efficient in delivering oxygen throughout the body. • It is a co-dominant trait that was caused by a mutated hemoglobin protein.

41. The Source of SSA

42. Sickle Cell Anemia • Sickle Cell Anemia: • Can have troublesome side affects including: • Bone & abdominal pain • Fatigue • Fever • Delayed growth • Blood clots in arteries • Chest pain • And possibly death…especially in low oxygen levels (at high altitudes).

43. Tie To Prior LearningComplete the Punnett Square & Determine the % that will have the Sickle Cell Trait and who will be carriers.

44. A Strange Twist of Fate • Malaria is a parasitic disease that attacks RBC’s. • 40% of the world’s population has a high risk of contracting this (Asia, Africa, Central/South America). • Spread by infected mosquitoes, persons contracting malaria can come down with life threatening fevers, liver failure, and death. (#1 killer in 3rd world youth) • Whereas children who inherit full-fledged sickle cell anemia (both mutated alleles = homozygous recessive) can have both sickle cell and malarial complications, those who inherit just one mutated allele (therefore partially affected… it’s co-dominant meaning there are normal and faulty RBC’s) have a “survival advantage” to malaria and usually have no major sickle cell complications. • Most mutations are bad, and sickle cell anemia is, but sometimes mutations actually can have hidden benefits. Instituto Gulbenkian de Ciencia. "Mystery solved: How sickle hemoglobin protects against malaria." ScienceDaily, 29 Apr. 2011. Web. 31 Jul. 2012.

45. Summary: Please Write The… • 3 types of DNA mutations • 5 types of gene mutations • 5 types of chromosome mutations

46. The Original “CASH” • There is an interesting book from Dr. Richard Hawking titled “The Selfish Gene”. • In it he discusses the likely origination of nucleic acids found floating around in what’s called a “primordial soup”. • Imagine a gene the size of the word CASH floating around and mutations similar to the ones you performed in the opening exercise occurred over millions, possibly billions of years. • This may explain the initial variety of genetic material available to start the first organism. • What kind of organism could that be?

47. The Primordial Soup Theory • Imagine you were transported billions of years back into Earth's history. • Instead of sunny skies and clouds and trees and beaches and birds and beasts of the environment, evolutionists theorize that the Earth looked something like this, with ammonia, sulfur, methane, water, and amino acids…just the basic components of life around. • It’s from this that the first mutations are believed to have created life… if you believe in such.