1 / 6

Supplemental Figure S1

Supplemental Figure S1. IgG. Con. Snail1-Flag. DNA-PKcs. IgG. Snail1-Flag. IgG. Supplemental Fig. S2. Non-neoplastic. Case 1. Case 2. Case 3. Case 4. Case 5. DNA-PKcs. Human colon cancer. Snail1. DNA-PKcs. Adenocarcinoma. Snail1. Human lung cancer. DNA-PKcs.

odessa-valenzuela
Download Presentation

Supplemental Figure S1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Supplemental Figure S1 IgG Con Snail1-Flag DNA-PKcs IgG Snail1-Flag IgG

  2. Supplemental Fig. S2 Non-neoplastic Case 1 Case 2 Case 3 Case 4 Case 5 DNA-PKcs Human colon cancer Snail1 DNA-PKcs Adenocarcinoma Snail1 Human lung cancer DNA-PKcs Squamouse cell carcinoma Snail1

  3. Supplemental Fig. S3 Snail1 GenBank: AF131208.1 1 atgccgcgctctttcctcgtcaggaagccctccgaccccaatcggaagcctaactacagc M P R S F L V R K P S D P N R K P N Y S 61 gagctgcaggactctaatccagagtttaccttccagcagccctacgaccaggcccacctg E L Q D S N P E F T F Q Q P Y D Q A H L 121 ctggcagccatcccacctccggagatcctcaaccccaccgcctcgctgccaatgctcatc L A A I P P P E I L N P T A S L P M L I 181 tgggactctgtcctggcgccccaagcccagccaattgcctgggcctcccttcggctccag W D S V L A P Q A Q P I A W A S L R L Q 241 gagagtcccagggtggcagagctgacctccctgtcagatgaggacagtgggaaaggctcc E S P R V A E L T S L S D E D S G K G S(100) 301 cagccccccagcccaccctcaccggctccttcgtccttctcctctacttcagtctcttcc Q P P S P P S P A P S S F S S T S V S S 361 ttggaggccgaggcctatgctgccttcccaggcttgggccaagtgcccaagcagctggcc L E A E A Y A A F P G L G Q V P K Q L A 421 cagctctctgaggccaaggatctccaggctcgaaaggcctccaactgcaaatactgcaac Q L S E A K D L Q A R K A S N C K Y C N 481 aaggaatacctcagcctgggggcgctgaagatgcac K E Y L S L G A L K M H

  4. Supplemental Fig. S4 a * S100D Snail1 S100A * A549 WT Con b 0 5 10 Snail1 Migration activity (Fold increase) S100A S100D Con WT Snail1 Normal control CT26 cells CT26-WT CT26-S100A CT26-S100D β -Actin * S100D H&E Snail1 Normal Con WT S100A S100D S100A A549 * WT Con 2.5 0.4 0.6 0.8 1 1.2 E-cadherin promoter activity 2 1.5 Lung weight (%) * 1 0.5 0 WT Con S100D S100A Normal CT26

  5. 0 0 0 0 10 10 10 10 30 30 30 30 60 60 60 60 0 0 0 10 10 10 30 30 30 60 60 60 Supplemental Fig. S5 a NCI-H460 NCI-H460 Con Snail1 siRNA : SC Snail1 (IR, min) p-p53(Ser15) p53 g-H2AX Snail1 b-Actin c Snail-Flag b WT S100A S104A/S107A Snail1-Flag Snail1-Flag (IR, min) S104A / S107A S104A / S107A pCR3.1 pCR3.1 S100A p-p53(Ser15) S100A WT WT p53 Snail1 γ-H2AX β-Actin Snail1 NCI-H460 A549 β-Actin pCR3.1 3 WT S100A S104A-107A 1 DNA-PK kinase activity (Fold increase) 0.5 0 - - Snail1 + + + + + + H460 A549

  6. M059J 0 10 90 120 Supplemental Fig. S6 a * 60 * 50 40 Death(%) 30 20 10 0 - + - + Snail1 Si-Snail1 G2/M phase (%) b 100 80 c d 60 Death(%) 40 20 (IR, min) 30 60 0 Con Snail1 p-DNA-PKcs (Ser2056) * M059J DLD-1 * DNA-PKcs Snail1 Snail1/shDNA-PKcs 4500 * p-GSK3β(Tyr216) 4000 * 3500 * GSK3β 3000 β-Actin 2500 2000 1500 1000 500 (day) 0 14 19 26 29 33

More Related