1 / 17

From Gene to Protein

From Gene to Protein. How Genes Work. aa. aa. aa. aa. aa. ribosome. aa. aa. aa. aa. aa. aa. From gene to protein. nucleus. cytoplasm. transcription. translation. DNA. mRNA. protein. trait. Translation. from nucleic acid language to amino acid language.

pembroke
Download Presentation

From Gene to Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. From Gene to Protein How Genes Work

  2. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  3. Translation fromnucleic acid languagetoamino acid language

  4. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  5. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

  6. 1960 | 1968 Cracking the code • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT

  7. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  8. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  9. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  10. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  11. Loading tRNA • Aminoacyl tRNA synthetase (don’t need to know name) • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  12. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  13. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

  14. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

  15. Translation

  16. Can you tell the story?

  17. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

More Related