1 / 24

High-resolution mapping of meiotic crossovers and noncrossovers

High-resolution mapping of meiotic crossovers and noncrossovers. Wolfgang Huber EMBL-EBI. Meiotic recombination. Proper chromosome segregation. Increase of genetic diversity. Gene A. Gene B. Gene C. Gene A. Gene b. Gene c. Gene a. Gene b. Gene c. Gene a. Gene B. Gene C.

preston
Download Presentation

High-resolution mapping of meiotic crossovers and noncrossovers

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. High-resolution mapping of meioticcrossovers and noncrossovers Wolfgang Huber EMBL-EBI

  2. Meiotic recombination Proper chromosome segregation Increase of genetic diversity Gene A Gene B Gene C Gene A Gene b Gene c Gene a Gene b Gene c Gene a Gene B Gene C

  3. Double-strand break repair CO: NCO: Recombination initiates with a double-strand break in one DNA molecule. Only two DNA molecules (homologs) are shown here. Slide3

  4. Map all recombination events that occurred in 50 yeast meiosis using high-density tiling microarrays

  5. Experimental approach Mancera*, Bourgon*. Brozzi, Huber, Steinmetz (2008) Slide5

  6. Tiling array ~3 Mio PM 25-mer probes, starting every 4 bases (yeast: 12 Mbp) Probe set: group of probes which each exactly map to a unique locus and which interrogate a common polymorphism. Marker: one or more polymorphisms interrogated by the same probe set. 6: CTTCACTATTTGTACAGATCGCAAT 5: CTAACTTCACTATTTGTACAGATCG 4: GGCCCTAACTTCACTATTTGTACAG 2: GACTGGCCCTAACTTCACTATTTGT 1: GGAGGACTGGCCCTAACTTCACTAT S96: CCTCCTGACCGGGATTGAAGTGATAAACATGTCTAGCGTTA YJM789: CCTCCTGACCGGGATTGAACTGATAAACATGTCTAGCGTTA 3: GACTGGCCCTAACTTGACTATTTGT

  7. Recombination event inference (tetrad) intermarker-distance: median = 78bp Slide7

  8. High resolution 4163 crossovers, 2126 non-crossovers across 46 meioses. Slide8

  9. Complex events

  10. Genome-wide hot spot mapping Slide10

  11. Hotspots Identified 179 recombination hot spots Incl. all previously known except for HIS2:HIS4, ARG4, CYS3, DED81, ARE1/IMG1, CDC19, THR4, LEU2-CEN3 None overlapped centromere Hottest: 28% of spores (59% of meioses) 84% overlap a promoter 25% of bases in hot spot intervals overlap promoters, while 68% overlap coding sequences

  12. Recombination events per meiosis

  13. Correlation between localization of DSBs (initiation) and recombination events (outcome) - DSB log-ratio (Buhler et al. PLoS Biology 2007) - Event counts (Mancera et al. Nature 2008) Chr 3

  14. genome wide distributions of CO and NCO hotspots are different (p<0.0005) Slide14

  15. Genes with distinct expression profiles are asso-ciated with hotspots and hotspot subtypes Expression data from Primig et al., Nature Genetics (2000)

  16. Mutants Zki8 Spo11 Spo11 Zki8 Zip4 Zip2 Zip3 Rad50 Mre11 Xrs2 Zip1 Zip1 Dmc1/Rad51 Mer3 SDSA DSBR Msh4/Msh5 Mus81 Mms4 Mlh1 Mlh3 crossover crossover noncrossover

  17. Meiosis in a msh4 null mutant

  18. Interference between CO and NCO

  19. The genomic effect of gene conversions Per meiosis, ~2.1% of polymorphic positions converted to the opposite genotype Up to 1% of a meiotic product's genome subject to conversion per singlemeiosis Conversion favours GC (1.4% increase of GC content at SNP positions, event-weighted) Also, hotspots tend to be GC-rich However, hotspot are also more diverse! („allelic homogenization“ appears to be counteracted by other forces, e.g. mutagenicity)

  20. Recombination hotspots show moresequence diversity SNP frequency data from Sanger Institute's Saccharomyces Genome Resequencing Project (E. Louis, R. Durbin, D. Carter)

  21. Conclusions Semi-supervised classification using mixture modeling provides accurate genotype calls and effective call quality metrics. ~ 1% of a meiotic product’s genome may be subject to conversion in a single meiosis, and this has GC bias. Distinct distributions of crossovers and non-crossovers suggest that genomic position (local chromatin or sequence context) affects DSB resolution. Interference between crossovers and non-crossovers. Crossover interference is reduced in msh4 mutant but non-crossover rates are unaffected, supporting that distinct pathways lead to these events. Conversion hotspots unlink genomic regions from the linkage map.

  22. Acknowledgements EMBL HD Julien Gagneur Marina Granovskaia Sandra Clauder-Münster Fabiana Perocchi Wu Wei Zhenyu Xu Eugenio Mancera Ramos Richard Bourgon • Lars Steinmetz EBI • Simon AndersElin Axelsson • Ligia Bras • Alessandro Brozzi • Tony Chiang • Audrey Kauffmann • Greg Pau • Oleg Sklyar • Jörn Tödling • David Jitao Zhang • The contributors to the R and Bioconductor projects

  23. Clinical isolates of S. cerevisiae Clinical strain (YJM789) Laboratory strain (S288c) The common lab yeast Isolated from rotten fig in California in 1930s Domesticated: related to baker's yeast, wine-making and beer-brewing yeasts Genome sequence of S288c: A Goffeau et al. Science (1996) Isolated from immuno-compromised patients Pathogenic in mouse model of systemic infection Various fungal pathogenic characteristics: pseudohyphae, colony morphology switching Ability to grow at >37˚C – a virulence trait Genome sequence of YJM789: W Wei et al., PNAS (2007): 60k SNPS, 6k indels wrt S288c

More Related