1 / 72

As you come in

As you come in. Make two lists under the 2 headings: ‘Features I got from my mum and dad’ ‘Features I did not get from my mum and dad’. Learning objectives. Recall the differences between environmental and inherited effects What is a gene? How does a gene code for a polypeptide

quana
Download Presentation

As you come in

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. As you come in • Make two lists under the 2 headings: • ‘Features I got from my mum and dad’ • ‘Features I did not get from my mum and dad’

  2. Learning objectives • Recall the differences between environmental and inherited effects • What is a gene? • How does a gene code for a polypeptide Success criteria Complete bracelet models to describe translation. Take away knowledge of key terms.

  3. What is a ‘gene’?What is a ‘locus’? • Write on a post it note…. Stick it on to the chromosome I think a gene is a type of mythical creature with 3 heads…….

  4. Bracelet sequencing • Decide whether you are a chimp or a human: CTATTTGTGGT TCTGAGTTCTTA AAACCCAGTG CTTCGAAGG

  5. Making DNA • Order the originaldna sequence using colour code. • Make a complimentary strand of DNA (remember DNA is a double helix) A = blue T = red G = black C = green

  6. Learning objectives • Be able to describe the genetic code • Explain and compare the structure of RNA(t and m) and DNA • Explain the preocess of transcription and splicing.

  7. The triplet code Given that there are four bases in DNA, and these code for 20 amino acids, what is the basis for the genetic code? If three bases = one amino acid, possible aminoacids= 64 (4×4×4) The existence of a three-base (triplet) code was confirmed by experiments by Francis Crick and his colleagues in 1961. The triplet code is degenerate, which means that each amino acid is coded for by more than one triplet.

  8. What is mRNA? When a polypeptide is required, the triplet code of its gene is converted into a molecule of messenger RNA (mRNA). This process is called transcription and is the first stage of protein synthesis. Like DNA, mRNA is a nucleic acid, but it differs in that: • it is single stranded, not double stranded • it contains ribose instead of deoxyribose mRNA strand during transcription • it contains uracil instead of thymine.

  9. tRNA molecule U A G

  10. Differences between DNA and RNA • Bases • Structure • Pentose sugar • Where is it found? • Quantity in cells • Stability?

  11. Transcription and codons During transcription, the mRNA is built up by complementary base pairing, using the DNA as a template. The DNA’s base triplets are converted into mRNA codons. What are the codons in the mRNA transcribed from this sequence of DNA base triplets? DNA T AC GC A G A T T AC A UG CGU CU A A UG mRNA The genetic code is non-overlapping: each base is only part of one triplet/codon, and each triplet/codon codes just one amino acid.

  12. OVERLAPPING AACGTAAGCACGTTCGCACCCCAAACACAC EACH CODON CODES FOR ONE AMINO ACID. However these may be the same amino acid.

  13. What is tRNA? In the cytoplasm, amino acids become attached to transfer RNA (tRNA) molecules. Each tRNA is specific for one amino acid. amino acid attachment site 3’ end Each tRNA molecule has a sequence of three bases called an anticodon. These are complementary to codons on the mRNA molecule. 5’ end hydrogen bond What is the anticodon for the codonAUG nucleotides UAC anticodon

  14. What is translation? Once a molecule of mRNA has been transcribed, it moves out of the nucleus via a nuclear pore. ribosome In the cytoplasm, the mRNA combines with a ribosome – the cellular structure on which the polypeptide chain will be built in a process called translation. mRNA strand How are the correct amino acids transported to the ribosome, and how are they linked together in the correct order?

More Related