Non-Culture Detection of Antimicrobial Resistance in Neisseria gonorrhoeae David L. Trees, Ph.D.

1. Non-Culture Detection of Antimicrobial Resistance in Neisseria gonorrhoeae David L. Trees, Ph.D. Division of STD Prevention Centers for Disease Control and Prevention

2. Agar Plate Dilution MIC Determination

3. Molecular Techniques for the Detection of Antimicrobial Resistance Mechanisms of Resistance: High level Penicillin and Tetracycline Gene based Ciprofloxacin (flouroquinolones) GyrA/ParC alterations & uptake/efflux Azithromycin (macrolides) mtrR, 23S rRNA & others? Cephalosporins Extended spectrum beta-lactamases/others

4. Molecular Techniques for the Detection of Antimicrobial Resistance Probe PCR Standard sequencing Microarray Transformation (Gonostat) Tm Analysis Pyrosequencing

5. Probe and Standard PCR Used for the detection of gene based resistances such as plasmid encoded penicillin (PPNG) and tetracycline (TRNG) Not effective in determining point mutation-based resistance.

6. Standard Sequencing Useful in determining point mutations and larger mutations such as those found in some of the azithromycin resistant isolates. Also good at determining the presence of previously reported mutations that are related to resistance. Sequencing long stretches of DNA can be time consuming.

7. Mtr region of AziR isolates promoters mtrC mtrR mtrC mtrR mtrF ATG TAA base 1120 base 1606 153 bp insert AGTGGATTAACAAAAACCAGTACGGCGTTGCCTCGCCTTAGCTCAAAGAGAACGATTCTCTAAGGTGCTGAAGCACCAAGTGAATCGGTTCCGTACTATTTGTACTGTCTGCGGCTTCGTCGCCTTGTCCTGATTTTTGTTAATCCACTATAT

8. Ciprofloxacin – Mechanism of Resistance Fluoroquinolones inhibit the replication of DNA Mutations in two genes involved in DNA replication results in resistance. gyrA: encodes for A subunit of DNA gyrase. parC: encodes for subunit of topoisomease IV.

10. Microarray Assays Good at detecting known mutations and giving their exact location in the gene sequence. Will not detect new mutations. Will not confirm resistance.

11. GyrA Microarrays

12. ParC Microarrays

13. Thailand

14. Tm Analysis Will detect the presence of a point mutation(s) within a given probe length. Will also detect the presence of non-identified mutations if they occur within the specified DNA sequence. Will not (at this point) specify the exact location of the mutation and therefore can not identify “silent” mutations.

15. Melting Curve Analysis

17. GONOSTAT Detection of gonococcal infection Non NAAT confirmatory test Can be used with specimens suspended in BD lysis buffer, Amplicor buffer or M4. In vitro detection of Cip, Azi, Spc Tested clinical specimens for Cip

18. GONOSTAT Gonostat is a DNA transformation assay for the detection of N. gonorrhoeae in clinical specimens. The recipient gonococcus contains a mutation that prevents growth unless it is transformed by a “wild-type” gene provided by gonococcal DNA present in the specimen. Gonostat does not require a viable isolate and specimen does not require refrigeration or freezing, making the assay extremely useful in resource poor settings.

19. Standard Gonostat Transformation Detection Assay 1.Send swabs to collection site. 2.Swab can be stored at room temperature for shipment back to testing site. 3.Place swab in 400 μl of solution A to lyse bacteria. 4.Add ~400 μl of solution B to neutralize. Will get colorimetric change. 5.Place 100 μl of solution onto a preplated lawn of Gonostat recipient bacteria. 6.Incubate for 24-48 hours and look for bacterial growth. 7.> 10 colonies is positive test.

20. Gonostat Transformation Assay for Detection of Antimicrobial Resistance • Transformation reaction as described in gonostat protocol. • Grow up on Choc Agar Plate. • Harvest all colonies into 2.0 ml Meuller Hinton Broth • Centrifuge for 5 minutes • Resuspend in 2.0 ml PBS. • Place 0.2ml on antibiotic plates in lawn formation. • Incubate at 37 degrees and read after 24-48hours.

21. Detection of Ciprofloxacin Resistance from spiked NAAT Buffers; With and Without Ethanol Precipitation Positive control transformant gave a MIC of 0.03 GyrA and ParC alterations in the transformant were identical to those in the donor isolate

22. Detection of decreased susceptibility to ciprofloxacin in clinical specimens: Guangzhou, China Currently >95% CipR N. gonorrhoeae Urethral swabs , most with corresponding culture isolate, from 19 patients were tested by Gonostat The swabs were collected between February and June, 2003 and stored at room temperature and tested at CDC between December 2003 and February 2004. Of the 19 specimens; Six had no growth on the original transformation plate, two had between 45 to 60 colonies (coded 1+), eight had to many colonies to count (3+), and three had confluent lawn growth (4+) on the original transformation plate. Acknowledgement to Wei Lai MD, Guangzhou, China

23. Clinical Studies – Antimicrobial Susceptibilities and Mutation Patterns

24. CONCLUSIONS Able to use Gonostat to detect resistance to: Ciprofloxacin – Both clinical specimens and spiked specimens Azithromycin – spiked specimens Spectinomycin – spiked specimens Could perform the assay on specimens in NAAT Buffers Dilution experiments suggest that between 5x103 to 5x105 “chromosomal equivalents” are needed to detect resistance. Detection did not require viable organisms or refrigeration/freezing equipment

25. PYROSEQUENCING Real-time sequencing for microbial identification and resistance typing

26. What is Pyrosequencing? • A genetic analysis method based on the principle of sequencing by synthesis • This system is able to deliver sequence information within minutes • The output data is real sequence data – the Gold standard • Uses include microbial identification and resistance detection

27. Advantages of Pyrosequencing • Sequencing directly from PCR product • Batch analysis of 96 samples in less than 1 hour • Only 2 pipetting steps needed to start and complete the process • Automatic sequence calling • Direct detection and analysis of SNPs, insertions, and deletions

28. Setting up a Run • Place cooled PSQ plate into machine • Can run in SNP or SQA modes • Enter sequence information • Enter dispensation order • Can program exact sequence • Or can repeat ACGT for unknown or highly variable sequences

29. Applications • Detecting fluoroquinolone resistance in Neisseria gonorrhoeae conferred by GyrA and ParC mutations

30. Sample PyrogramGyrA • 11.17.2005 - Well A1 • Entry: GYRA2-3SEQx2 • Sample: JH1 • Result: GATTTCGCAG TTTACGGCAC CATCGTCCGT ATGGCGC • Rev. Comp: GCGCCATACG GACGATGGTG CCGTAAACTG CGAAATC • Quality: Passed (Quality window: 20)

31. Result GyrA GyrA WT: GAT TCC GCA GTT TAC GAC ACC ATC Asp Ser Ala Val Tyr Asp Thr Ile ↓ ↓ Result: GAT TTC GCA GTT TAC GGC ACC ATC Asp Phe Ala Val Tyr Gly Thr Ile Two Amino Acid changes = Fluoroquinolone Resistance

32. Sample PyrogramParC • 12.12.2005 - Well A9 • Entry: PARC1-3SEQ • Sample: PJH20 • Result: GCCTATGGGG CGATGGTGCG CATGGCTCAG • Rev. Comp: CTGAGCCATG CGCACCATCG CCCCATAGGC • Quality: Passed (Quality window: 20)

33. Result ParC • ParC WT: GCC TAT GAG GCG Ala Tyr Glu Ala ↓ • Result: GCC TAT GGG GCG Ala Tyr Gly Ala *Amino Acid change = Fluoroquinolone Resistance

34. Molecular Techniques for the Detection of Antimicrobial Resistance Potential applications? Used to state that an isolate is resistant? Used on NAAT specimens to determine resistance? Used as a surveillance/screening tool to predictprevalence of resistance?

35. Acknowledgements to “ The Staff ”