1 / 14

Initial sample: one or several DNA molecules of interest

Initial sample: one or several DNA molecules of interest. PCR: Polymerase Chain Reaction Ingredients: - many copies of two primers corresponding to the desired start and end location - many copies of nucleotides (C,G,A,T)

roman
Download Presentation

Initial sample: one or several DNA molecules of interest

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Initial sample: one or several DNA molecules of interest PCR: Polymerase Chain Reaction Ingredients: - many copies of two primers corresponding to the desired start and end location - many copies of nucleotides (C,G,A,T) - many copies of heat-resistant DNA polymerase ? Desired result: billions of identical copies, all starting and ending at prescribed locations

  2. Illustration of the PCR primers. <-(“with the grain”) GACTGGA | | AGGCTAACGGTGCATCGTTAAACCGTACCGTTAGCTGGTAGCTAGCATGCTGACCTTGACATT TCCGATTGCCACGTAGCAATTTGGCATGGCAATCGACCATCGATCGTACGACTGGAACTGTAA | | AACGGTGC -> (“with the grain”)

  3. 1) Heat up to 95 C: DNA strands separate

  4. 2) Cool down to 55 C: the primers attach

  5. 0/2 = desired / background DNA molecules 3) Heat up to 72 C: polymerases complete the complementary strands as far as the template strands go

  6. 0/2 1) Heat up to 95 C: DNA strands separate

  7. 0/2 2) Cool down to 55 C: the primers attach

  8. 0/2 0/4 3) Heat up to 72 C: polymerases complete the complementary strands as far as the template strands go

  9. 0/2 0/4 1) Heat up to 95 C: DNA strands separate

  10. 0/2 0/4 2) Cool down to 55 C: the primers attach

  11. 0/2 0/4 2/6 3) Heat up to 72 C: polymerases complete the complementary strands as far as the template strands go

  12. 0/2 0/24 2/6 ? 1) Heat up to 95 C: DNA strands separate

  13. 0/2 0/4 2/6 2) Cool down to 55 C: the primers attach

  14. 0/2 0/4 2/6 8/8 22/10 52/12 114/14 240/16 After 20 steps: 1,048,536 / 40 3) Heat up to 72 C: polymerases complete the complementary strands as far as the template strands go

More Related