Random Design Building Bridges Between Science and Faith

1. Random DesignBuilding Bridges Between Science and Faith

2. Higher Order Thinking in Biology Education Science Language Communication Culture Mathematics Music History Art Religion Information Science Connecting the Dots

3. Higher Order in Biology Molecules to Mankind I am I believe I think

4. Higher Order ThinkingRequires: • Openness/receptive to new dots • Acquisition of new Dots • Dots accurate and well-defined • Processing Time

5. Barriers to Higher Order Thinking • Limiting input of new dots • Misunderstanding dots • Focusing on wrong dots • Language and Communication • Personal • Community/Transferance

6. Language Problem!Modern Day ‘Tower of Babel’ Examples: • Science • Evolution • Creationist • Random • Naturalism • Christian • Mutation * Emotional obstacles

7. Coming to Terms with TermsDefinitions of Evolution • Evolution, change through time (generic) • Evolution, (genetic mechanisms and development) • Evolution, (atheistic) • Chemical evolution (first life) Is evolution a theory or a fact? Evolution is a theory AND a fact! Fact - biological evolution has, and is occurring. Theory – explains many diverse facts from different scientific disciplines.

8. Science and Faith The Crux of the Issue: • Scientists are suspicious that Christians want to insert religious beliefs into science • Christians fear that science seeks to remove God from the picture altogether. Are these suspicions and fears warranted? Who will stop the cycle?

9. Understanding Randomness • Apparent random processes are biological realities. • Sperm/egg • Biochemical/physical reactions • Immunity • Random Mutation and Selection (Evolution)

11. DNA Sugar Hemoglobin Cells

12. Antibodies

13. Genetic Record: Chromosome Comparisons of Humans and Apes

14. Understanding Randomness • Haphazard, coincidence, chance, purposeless. • Equal opportunity of occurrence! Biology as an equal opportunity process. If random is defined as purposeless, then connecting this dot to a purposeful God is IMPOSSIBLE!

15. Is Anything Truly Random? 21344321143223411342 21344321143223411342 21344321143223411342

16. Is Anything Truly Random? 01123581321345589 (Fibonacci Numbers)

17. Is Anything Truly Random? 213313424413241441323323223131 213313424413241441323323223131 Adenine = 1 Thymine = 2 Cytosine = 3 Guanine = 4 TACCACGTGGATGAGGACTCCTCTTCAGA AUGGUGCACCUGACUCCUGAGGAGAAGUCU Met - Val - His - Leu -Thr - Pro - Glu - Glu - Lys –Ser (Hemoglobin gene codes for Hemoglobin Protein) It is music to the ear! Listen!

18. A Super Intelligence Would Know No True Randomness • EVERYTHING, regardless of deep complexity and apparent random nature, would actually possess logical, orderly, and purposeful connections. **Randomness and evolution need not detract from belief in God: They can be viewed as part of a purposeful plan.

19. Fundamental Questions: --Does the creative logic revealed by science demonstrate the existence of a Creator? OR --Does the existence of innately creative natural laws eliminate God from the picture altogether? Honest answers to honest questions…

20. Random (Equal Opportunity) DesignA New Model for Science EducationBuilding Bridges Instead of Barriers A New Direction Needed: • Win/Win: Each side granted core needs • Commit to solutions - Set positive examples. • Strengthen/affirm science and religious belief. • Recognize role of language/emotions. • Embrace and respect student diversity

21. Random (Equal Opportunity) Design A New Model for Science Education Random Design - a powerful process for creating higher order, especially in living beings. Harnessing the laws of randomness, it functions by first generating large arrays of potential building blocks from which the most suitable candidates are sequentially incorporated into an ever-advancing architectural design.

22. Random (Equal Opportunity) Design A New Model for Science EducationHow does Random Design Work? Random Design has three components: 1. The Driver imparts directionality to the world. 2. The Mixer uses combinatorial mathematics to create infinite new possibilities for diversity – the raw material for extending order and structure. 3. The Selector.

23. Random (Equal Opportunity) Design A New Model for Science EducationHow does Random Design Work? Question: Presented with a problem to solve and no limitations of time and resources, which of the following approaches would most likely arrive at the best solution? • Think the problem through as best as possible, then try what seems to be the one best idea. • Think the problem through as best as possible, then try the best 10 ideas. • Try all potential possibilities.

24. This expansive approach is biology’s solution as well. In short, it is Random Design. Examples: • Four chemical bases of DNA -- infinite # of genes. • Infinite genes -- infinite # of proteins. • Infinite # of proteins -- infinite diversity of life. Key Point: Random Design has virtually no Limits! The magic of combinatorial mathematics continuously searches for the very best solutions to life’s dynamic and never-ending challenges - the best, and perhaps only creative process up to the task of beginning, nurturing, and sustaining life on earth.

25. Random (Equal Opportunity) DesignA New Model for Science Education Strengthening Science: • Recognizes that science must be free to pursue truth wherever it leads. • Refuses to redefine or compromise integrity of science to meet religious standards. • Does not explain biological processes and mechanisms in supernatural terms.

26. Random (Equal Opportunity) DesignA New Model for Science Education Strengthening Religious Faith: • Permanent secure place for plausibility of Creator. • Ecumenical, offering a larger more expansive vision of God as Creator. • Restores credibility of religious representatives. • Viable platform to restore trust and relationships.

27. The Alpha and the Omega