Barcoding the Birds of Argentina

1. Barcoding the Birds of Argentina Saltator aurantiirostris Saltator similis Saltator caerulescens 1 Saltator caerulescens 2 Darío A. Lijtmaer1 and Kevin C. R. Kerr2 1Museo Argentino de Ciencias Naturales “B. Rivadavia”, Argentina 2University of Guelph, Canada

2. Birds of Argentina Almost 1000 species 25% of the birds of the Neotropics About 10% of the birds of the world

3. Birds of Argentina • Representative of the southern cone of South America: • 100% of the birds of Uruguay • 95% of the birds of Paraguay • 85% of the birds of Chile • 52% of the birds of Bolivia • 94% of the birds of southern Brazil (Rio Grande do Sul)

4. Birds of Argentina

5. Birds of Argentina

6. Barcoding the Birds of Argentina Main objective: to obtain the barcodes of all the species of birds of Argentina by the end of 2008 • Additional objectives: • Comparison of patterns of COI variation between: • Cold temperate and subtropical areas • Northern and southern hemispheres • High altitude and lowland areas

7. 2006 900 samples loaned to Guelph, lab training 2007 420 samples loaned to Guelph 2003 Tissue collection started 2004 MACN signed the MOC 2006 Lounsbery Foundation grant 2005 project started 2006 Field trip training Barcoding the Birds of Argentina 2003 2004 2005 2006 2007 2008

8. Barcoding the Birds of Argentina Collecting trips Tissues and vouchers stored at MACN AATCGATCCTAGTACTCGATCCTAGTACCA Sub-samples loaned to Guelph

9. Barcoding the Birds of Argentina Collecting trips Tissues and vouchers stored at MACN Samples processed at MACN (extraction and amplification) AATCGATCCTAGTACTCGATCCTAGTACCA Amplified DNA loaned to Guelph

10. Preliminary results Barcodes were obtained for 809 individuals and 316 species (1/3 of the species of Argentina)

11. 0.23% in North America 7.93% in North America (260 species) Preliminary results The COI sequence was never shared between species COI sequences were obtained for more than one individual in 233 species (74% of the species barcoded). Mean intraspecific distance was 0.28% Mean interspecific distance between species of the same genus was 7.95% (28-fold higher than mean intraspecific distance)

12. Preliminary results In only 1 pair of species COI distances were not smaller within species than between species Muscisaxicola flavinucha Muscisaxicola cinerea Intraspecific distances: 0 - 0.46% Interspecific distances: 0.43 - 0.46%

13. For 99% of the species barcoded so far, an individual could be correctly identified based on its COI sequence Preliminary results In only 1 pair of species COI distances were not smaller within species than between species In 99% of the species COI clusters did not overlap with those of other species

14. Preliminary results 4 other cases in which interspecific distances were lower than 1% Veniliornis frontalis and Veniliornis passerinus Distance: 0.29% Veniliornis passerinus Veniliornis frontalis

15. Preliminary results 4 other cases in which interspecific distances were lower than 1% Anas puna and Anas versicolor Distance: 0.43 - 0.72% Anas cyanoptera 1 Anas cyanoptera 2 Anas platalea Anas puna 1 Anas puna 2 Anas versicolor 1 Anas versicolor 2

16. Preliminary results 4 other cases in which interspecific distances were lower than 1% Anas puna and Anas versicolor Distance: 0.43 - 0.72% Carduelis crassirostris and Carduelis atrata Distance: 0.43 - 0.58% Mimus triurus and Mimus dorsalis Distance: 0.72 - 0.87%

17. Preliminary results 3 species in which intraspecific distances were higher than 2.8% (10 times mean intraspecific distance) Troglodytes aedon (up to 3.25%) Cistothorus platensis (up to 4.95%) Leptasthenura aegithaloides (up to 3.72%)

18. Preliminary results In conclusion, our preliminary results suggest that: • The COI sequence can be efficiently used for identification purposes 2) At the same time, the use of the COI can be useful to flag interesting species or groups of species 3) Patterns of COI divergence appear to be similar to those obtained for North American birds

19. 2500 2000 1500 1000 500 0 500 400 300 200 100 0 Project started Project started DIC 2003 DIC 2004 DIC 2005 DIC 2006 DIC 2003 DIC 2004 DIC 2005 DIC 2006 Additional benefits of the project 1) Tissue Collection Specimens Species The project boosted the MACN tissue collection: three times increase in specimens and about two and a half times increase in species during last year.

20. Additional advantages of the project 2) Skins and skeletons All tissue samples collected have associated vouchers 3) Certification of the identity of specimens in the collection Barcodes can be used to verify the correct identification of tissue samples, skins and skeletons

21. Additional advantages of the project 4) Control of legal and illegal trade of bird species Podiceps gallardoi

22. The future • Currently: 33% of the species of Argentina barcoded

23. The future • Currently: 33% of the species of Argentina barcoded • Mid 2007: 50% of the species barcoded

24. The future • Currently: 33% of the species of Argentina barcoded • Mid 2007: 50% of the species barcoded • End of 2007: 70% of the species barcoded

25. The future • Currently: 33% of the species of Argentina barcoded • Mid 2007: 50% of the species barcoded • End of 2007: 70% of the species barcoded • End of 2008: 100% of the species barcoded

26. The future • Currently: 33% of the species of Argentina barcoded • Mid 2007: 50% of the species barcoded • End of 2007: 70% of the species barcoded • End of 2008: 100% of the species barcoded • Integration of our results with those of other studies undertaken in the Neotropics and in other regions of the world.

27. Thank you