1 / 35

Transcription, Translation & Protein Synthesis

Transcription, Translation & Protein Synthesis. Do you remember what proteins are made of ?. Hundreds of Amino Acids link together to make one Protein

schrock
Download Presentation

Transcription, Translation & Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Transcription, Translation &Protein Synthesis

  2. Do you remember what proteinsare made of ? • Hundreds of Amino Acids link • together to make one Protein • 􀂄 There are 20 types of amino acids, some • we can make, and some we can’t • 􀂄 There are infinite combinations of amino • acids • 􀂄 Can be hundreds or thousands monomers Long These long chains are called polypeptide chains

  3. Protein Synthesis • Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. • However: • DNA is only found in the nucleus • Proteins are only made outside the nucleus – in the cytoplasm. • Houston, we have a problem.

  4. Protein Synthesis • How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? • A molecular cousin of DNA – RNA – is used to carry these messages.

  5. Ribonucleic Acids (RNA) • The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). • There are three types of RNA: • mRNA – carries a message from the DNA to the cytoplasm • tRNA – transports amino acids to the mRNA to make a protein • rRNA – make up ribosomes, which make protein.

  6. Ribonucleic Acids (RNA) • RNA is almost exactly like DNA, except: • Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) • Contains uracil instead of thymine. • RNA is single-stranded, not double-stranded (usually…)

  7. Ribonucleic Acids (RNA)

  8. Protein Synthesis • Occurs in TWO steps: • Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA • Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA.

  9. DNA RNA R E N P T O I The Central Dogma • This order of events is called the central dogma of molecular biology:

  10. Step One: Transcription • DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. • Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? • New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand.

  11. Step One: Transcription • Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf • Watch the more complex animation! • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html

  12. Step One: Transcription • Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT

  13. Step One: Transcription • Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA

  14. Step 1½: RNA Editing • An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. • An mRNA sequence that does NOT code for protein is called an intron. A sequence that is useful in making a protein is called an exon.

  15. DNA transcription pre-RNA (in nucleus) exon 1 exon 2 intron exon 3 intron RNA editing intron exon 1 exon 2 exon 3 intron RNA (in cytoplasm) Step 1½: RNA Editing

  16. Step Two: Translation “to decode ordecipher the meaning of” • Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. • How does the mRNA sequence translate into an amino acid sequence?

  17. G T C A phe ile val pro ala his asn asp cys arg leu met ser thr tyr gln lys glu trp gly Step Two: Translation • Problem: • There are 20 different amino acids. • There are 4 RNA bases.

  18. Step Two: Translation • Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/translation.swf • Watch the more complex animation! • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html

  19. A U G G G C U U A A A G C A G U G C A C G U U • This is a molecule of messenger RNA. • It was made in the nucleus by transcription from a DNA molecule. codon mRNA molecule

  20. ribosome A U G G G C U U A A A G C A G U G C A C G U U A ribosome on the rough endoplasmic reticulum attaches to the mRNA molecule.

  21. Amino acid tRNA molecule anticodon U A C A U G G G C U U A A A G C A G U G C A C G U U A transfer RNA molecule arrives. It brings an amino acid to the first three bases (codon) on the mRNA. The three unpaired bases (anticodon) on the tRNA link up with the codon.

  22. C C G U A C A U G G G C U U A A A G C A G U G C A C G U U Another tRNA molecule comes into place, bringing a second amino acid. Its anticodon links up with the second codon on the mRNA.

  23. Peptide bond C C G U A C A U G GG C U U A AA G C A G U G C A C G U U A peptide bond forms between the two amino acids.

  24. C C G U A C A U G GG C U U A AA G C A G U G C A C G U U The first tRNA molecule releases its amino acid and moves off into the cytoplasm.

  25. C C G A U G GG C U U A AA G C A G U G C A C G U U The ribosome moves along the mRNA to the next codon.

  26. C C G A A U A U G G G C U U A A A G C A G U G C A C G U U Another tRNA molecule brings the next amino acid into place.

  27. C C G C C G A U G G G C U U A A A G C A G U G C A C G U U A peptide bond joins the second and third amino acids to form a polypeptide chain.

  28. G U C A C G A U G GG C U U A AA G C A G U G C A C G U U The process continues. The polypeptide chain gets longer. This continues until a termination (stop) codon is reached. The polypeptide is then complete.

  29. ? Step Two: Translation • Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met

  30. The Genetic Code

  31. The Genetic Code

  32. met ??? arg thr asp arg ser asp Step Two: Translation • Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

  33. The Genetic Code

  34. met met thr asp arg ser asp STOP Step Two: Translation • Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA

  35. RECAP: • DNA is transcribed into mRNA in the nucleus. • The mRNA leaves the nucleus and enters the cytoplasm. • The protein is translated from the mRNA sequence using tRNA and amino acids.

More Related