1 / 10

Sharina S.N., Kartavtsev Y.P.

Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 ( Co-1) and cytochrome b (Cyt-b) genes . Sharina S.N., Kartavtsev Y.P. INTRODUCTION. The phylogenetic relationships within the order are still problematic

suki
Download Presentation

Sharina S.N., Kartavtsev Y.P.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Phylogenetic analysis of flatfish species (Teleostei, Pleuronectiformes) based on cytochrome oxidase 1 (Co-1)and cytochrome b (Cyt-b) genes Sharina S.N., Kartavtsev Y.P.

  2. INTRODUCTION • The phylogenetic relationships within the order are still problematic • Fish mitochondrial DNA is now widely used with phylogenetic purposes • Most popular in phylogenetics are sequences ofcytochrome b(Cyt-b) and cytochromeoxidase 1 (Cо-1) genes, which used for taxa comparison at the species-familylevel.

  3. Aim:Molecular phylogeneticinvestigation of relationships among order Pleuronectiformes • To make reconstruction the phylogenetic relationships based on Co-1and Cyt-b gene sequencing among some flatfishspecies were made. • To confirm or disprove the monophyly of the flatfish familyPleuronectidae and genus Pleuronectes several tree types were built.

  4. Materials and methodsSamples of the collection Kievka Bay Vostok Bay

  5. (Kartavtsev et al., 2007) • Flatfish-cytb-F – ATGGCCAACCTCCGTAAATCCCACCCCCTTC • Flatfish-cytb-R – CTGGGGCTCTGGACGCTGAGCTACTAGTGC (~1441 bp) 20 spesies of Pleuronectiformes for Co-1gene 47 species of Pleuronectiformes forCyt-b gene 2 species of Gadiformes as outgroup • Flatfish-1-F TCTTTAGATTTGCAATCTAACATGTA • Flatfish-1-R GTCAGTAGCATTGTAATTCCTGCGGC • Flatfish-2-F TGGGCCCATCACATATTTACAGTCGG • Flatfish-2-R CAGAGCGGTTATGTGGTTGGCTTGAA (~1500 bp)

  6. Rooted consensus (50%) MP-tree showing phylogenetic interrelationships on the basis of Co-1 sequence data. In the nodes bootstrap support (n=1000) for MP and NJ (MP/NJ) are shown. The tree was rooted with the sequences of two out-group species: Gadiformes.

  7. Rooted consensus (50%) BA-tree showing phylogenetic interrelationships on the basis of Cyt-b sequence data. In the nodes bootstrap support (n=1000) for NJ and MP and repetition frequencies for n=106 simulated generations for BA (BA/MP/NJ) are shown. The tree was built based on the TrN+I+G model and was rooted with the sequences of two out-group species: Gadiformes.

  8. Hippoglossinae Hippoglossoidinae Pleuronectinae

  9. Conclusions: • Family Pleuronectidae with high confidence may be considered as monophyletic. • According the last systematical revision, we have sampled in the genus Pleuronectes only one species P. pinnifasciatus. Other species, placed in different genera Pseudopleuronectes, Liopsetta, and Lepidopsetta. • The diagnostics of species (barcoding) based on Co-1 and Cyt- b gene sequences is highly effective because of low intraspecies and high interspecies variability of this markers.

  10. THANKS FOR ATTENTION!

More Related