UNIT 5

1. UNIT 5 Chapter 17: From Gene to Protein Chapter 18: Microbial Models Chapter 19: The Organization & Control of Eukaryotic Genomes Chapter 20: DNA Technology

2. Introduction • The Central Dogma is the molecular “chain of command” in a cell • DNA  RNA  proteins • Transcription: DNA used to make mRNA • Translation: mRNA used to make protein/polypeptide

3. Transcription: RNA Synthesis • RNA polymerase uses a template strand of DNA to base pair with • Transcription includes: initiation, elongation, termination • Initiation: RNA polymerase identifies template strand by presence of promoter • TATA box • Transcription factors

4. RNA polymerase base pairs RNA nucleotides with the template strand • Uracil is used in RNA rather than thymine

5. Elongation: double helix unwinds as RNA polymerase adds nucleotides • New RNA “peels off” of the DNA as it reforms the helix • A single gene can be transcribed by many RNA polymerase molecules at once

6. Termination: elongation proceeds until a terminator is encountered • Primary transcript is released • In eukaryotes, the transcript is to be modified

7. RNA Processing • Before translation, the primary transcript undergoes processing • 5’ cap: added to the 5’ end to prevent digestion by enzymes, also includes attachment site for ribosomes • Poly-A tail: added to the 3’ end to prevent digestion by enzymes, also helps with exportation from nucleus

8. RNA splicing: non-coding sequences, introns, are removed, leaving only exons • Spliceosomes made up of snRNPs facilitate splicing of the exons

9. Translation: Polypeptide Synthesis • The newly created mRNA (messenger RNA) enters the cytoplasm and is attached to a ribosome • Codons indicate which tRNA is complimentary • tRNA (transfer RNA) carries amino acids to the ribosome • Anti-codons correspond to codons

10. Most codons correlate with a specific amino acid • Genetic code is redundant but not ambiguous • Start and stop codons

11. The genetic code is very old and connects to our scientific understanding of evolution • It is almost universal • Foreign genes can be expressed by organisms

12. There are 61 codons, but only 45 types of tRNA (anti-codons) • Base pairing rules are “relaxed” in the third position of the codon/anti-codon • Called wobble: U can base pair with A or G • The ribosome is the site of translation • P site: holds tRNA with growing polypeptide • A site: arrival site for next tRNA • E site: site for discharging tRNAs

13. Translation includes: initiation, elongation, termination • Initiation and elongation require energy: GTP • Initiation: brings together mRNA, first amino acid and two ribosomal subunits • First – small ribosomal subunit locates and attaches at start codon • Second – tRNA carrying appropriate anti-codon (and methionine) arrives and attaches to mRNA

14. Third – large ribosomal subunit arrives and covers the tRNA at the P site (GTP required) • Initiation is now complete

15. P A met met E UAC UAC 5’ CGCCAUGCCUAGCACAUGACCUA 3’

16. Elongation: brings together remaining tRNAs in order • First – the next tRNA will arrive and base pair with the codon at the A site • Second – using GTP, a peptide bond is formed between the new amino acid and the growing polypeptide • Third – using GTP, the mRNA and tRNA are moved in the 5’  3’ direction exactly three nucleotides (translocation)

17. P A met met pro pro met pro E UAC UAC GGA GGA 5’ CGCCAUGCCUAGCACAUGACCUA 3’

18. P A met pro met pro E UAC GGA UAC GGA 5’ CGCCAUGCCUAGCACAUGACCUA 3’ 5’ CGCCAUGCCUAGCACAUGACCUA 3’

19. P A ser ser met pro met met ser pro pro E GGA UCG GGA UCG UCG 5’ CGCCAUGCCUAGCACAUGACCUA 3’ 5’ CGCCAUGCCUAGCACAUGACCUA 3’

20. Summary of elongation

21. Termination: ribosome encounters a stop codon • A release factor will base pair with the stop codon and hydrolyze the polypeptide from the last tRNA • (Avg. protein translation: ~1 min)

22. Ribosomes • There are bound (on the rough endoplasmic reticulum) and free (in the cytoplasm) ribosomes • Bound: used to make proteins that will be secreted from the cell • Free: used to make proteins that will stay in the cytoplasm • Same mRNA can be translated by multiple ribosomes – polyribosomes

23. Prokaryotes • Two major differences between eukaryotes and prokaryotes • There is no RNA processing • What is transcribed IS the mRNA • Transcription and translation are coupled END

24. Bacterial Genetic Material • Bacteria possess a single chromosome • Double-stranded, circular • 4-6 million base pairs on average • Some bacteria carry plasmids with “non-crucial” genes • Separate from chromosome, also circular

25. Variation in Bacterial Genetics • Bacteria can acquire new genes by one of three methods: transformation, transduction, conjugation • Transformation: bacteria take up foreign DNA and incorporate it into their chromosome • Can also be plasmids • Transduction: phages act as vectors for bacterial DNA • Accidental and rare

26. Requires an F factor (fertility) – gene that allows for construction of a sex pilus • Hollow tube for transfer of plasmids • Most common type of shared plasmids = antibiotic resistance • Conjugation: bacterial “sex” is the direct transfer of genetic material between two bacteria

27. Regulation of Bacterial Genes • Bacteria have relatively simple control systems for their genes called operons • Method for bacteria to turn on genes when needed and off when not • Operons have three components: a promoter, an operator, the gene(s) it controls • Promoter: site to which RNA poylmerase binds • Operator: site to which repressor protein binds • Repressor protein is always present in the cell

28. The lac operon is an example found in E. coli • Genes produce proteins/enzymes to digest lactose • No lactose: • Repressor can bind to operator • Prevents RNA polymerase from transcribing genes lacZ, lacY, lacA • Lactose: • Lactose binds to repressor, changing its conformation so it cannot bind to operator • RNA polymerase can transcribe genes lacZ, lacY, lacA and digest the lactose END

29. Introduction • Eukaryotic DNA is much more complex than that of prokaryotes • Little is known about expression • Highly active area of research • Genome is typically larger • Cell specialization limits expression of genes • Human genome possesses ~20K to 30K genes • >97% of the genome is non-coding • DNA is associated with MANY proteins • Complex packaging can influence transcription • Loose packing = frequent transcription; tight packing = infrequent transcription

30. Gene Expression Controls • Only a small portion of a multicellular organism’s DNA is actively transcribed in any given cell • Cellular differentiation makes long-term control necessary • 200 cell types, 1 genome • Many levels of control exist to regulate expression in eukaryotes

31. Molecular Basis of Cancer • Oncogenes are cancer-causing genes • Arise from changes in a cell’s DNA (mutations) • Chemical agents (carcinogens) or physical mutagens can alter proto-oncogene function • Mutations in tumor-suppressor genes can also cause cancer • Control adhesion of cells, inhibit cell cycle, repair damaged DNA, initiate apoptosis

32. Example of proto-oncogene includes p53 • Mutations to gene occur in 50% of all cancers • Nicknamed the “guardian angel of the genome” • Damage to a cell’s DNA stimulates p53 expression • Acts as a transcription factor for several other genes • Activates p21 gene which halts cell cycle • Turns on genes involved in DNA repair • If damage is irreparable, it turns on “suicide genes” which causes cell death – apoptosis

33. Development of Cancer • Usually, many mutations must occur for cancer to develop • Cancer is caused by the accumulation of mutations & mutations occur throughout life  the longer we live, the more chance of cancer • Many malignant tumors have an active telomerase gene • Viruses (esp. retroviruses) account for 15% of cancers • They may donate oncogenes or disrupt tumor-suppressor genes or convert a proto-oncogene END

34. Restriction Enzymes • In nature, bacteria use restriction enzymes to cut foreign DNA • Restriction enzymes cut DNA at specific sites • Enzymes identify a restriction site to cut at • Restriction sites usually occur at many places in a sequence of DNA

35. Restriction sites may occur at many locations, so the enzyme will make many cuts • Often times, a staggered cut is made, producing sticky ends that can base pair with its compliment

36. DNA Cloning Vectors • Bacterial plasmids are used as cloning vectors • DNA molecule that carries foreign DNA into a cell • Bacteria can pass on their plasmids to daughter cells • Less complex than eukaryotes, reproduce faster • Cloning a human gene in bacteria steps • Isolation of vector and gene of interest • The vector is a plasmid • Plasmid engineered to carry a gene for resistance to an antibiotic

38. Insertion of gene of interest into vector • Restriction enzymes used on both plasmid and gene of interest to produce compatible sticky ends • Gene and plasmid fragments mixed and DNA ligase joins them together • Introduction of recombinant vector into cells • Bacteria are transformed by taking up plasmid • Both recombinant and non-recombinant bacteria are created

39. Cloning of cells (and gene of interest) • Bacteria are spread onto agar plates containing an antibiotic • Antibiotic ensures that only bacteria with the plasmid will grow • Transformed bacteria display “extra” trait

40. Complimentary DNA - cDNA • RNA processing doesn’t occur in prokaryotes, so it can be difficult to get them to express eukaryotic DNA • A fully processed mRNA is needed since its lacking introns • mRNA acts as a template for making DNA • Reverse transcriptase used to make DNA from RNA • Reverse transcriptase isolated from retroviruses • Product is a cDNA molecule, DNA with no introns compatible with bacterial DNA

41. Creation of cDNA

42. PCR • The Polymerase Chain Reaction (PCR) can be used to create billions of copies of a segment of DNA in a few hours • No cells are needed • Nucleotides, primers, DNA polymerase added into a test tube with our DNA to be copied

43. PCR • Special DNA Polymerase is used

44. Since 1985, PCR has had a huge impact on biotechnology and DNA from a variety of sources has been amplified • A 40,000 year old frozen wooly mammoth • TINY amounts of blood or semen (or other DNA evidence) from crime scenes • Embryonic cells for rapid diagnosis of genetic disorders • Viral genes from difficult-to-detect viruses like HIV END