1 / 17

Marine Bacteria Cultivation Michael Clement Dr. Stephen Giovannoni

Marine Bacteria Cultivation Michael Clement Dr. Stephen Giovannoni. Purpose. To culture and grow ecologically important marine bacteria from a complex marine environment Cultivation of marine microbes is difficult but necessary for phenotypic and genotypic analysis. Background.

tarala
Download Presentation

Marine Bacteria Cultivation Michael Clement Dr. Stephen Giovannoni

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Marine Bacteria CultivationMichael ClementDr. Stephen Giovannoni

  2. Purpose • To culture and grow ecologically important marine bacteria from a complex marine environment • Cultivation of marine microbes is difficult but necessary for phenotypic and genotypic analysis

  3. Background • We know lots of different marine organisms exist because we can detect their DNA • Most organisms we can detect we cannot grow in the lab

  4. Background • SAR11 is abundant in marine waters worldwide • SAR11 plays a large, but not well understood role in the carbon cycle • SAR11 has been cultivated in the laboratory

  5. Growth Medium • Oregon coast seawater filtered with a 0.1 micron filter • Autoclaving vs. Not autoclaving

  6. Inoculation • 24-well Teflon plates • 5ml medium/well • Inoculate at 2.5 cells/well • Inoculated 144 wells • 24 negative control wells • Grew for three months

  7. Growth Assessment • Guava flow cytometer • DNA binding dye • Assess cell density of culture

  8. Growth Assessment Positive wells determined by visual comparison of Guava reads to uninoculated wells

  9. Analysis • PCR • Gel electrophoresis • RFLP • Determine unique patterns

  10. Growth results • 34% culturability • Some co-cultures and some pure culltures • Negative control wells had no growth

  11. RFLP Results

  12. >7C6R_8294-27F_H03_009.ab1 Uncultured Thiotrichales ACTTAACGCGTTAGCTTCGCCACTAAAGGGTAAATCCCCCCAACGGCTAGTTATCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTACCCACGCTTTCGTACCTCAGCGTCAGTATTGGTCCAGAAAGCTGCCTTCGCCATTGATGTTCCTTCTGATATCTACGCATTTCACCGCTACACCAGAAATTCCACTTTCCTCTACCATACTCTAGTTGACCAGTTTCAAATGCAGTTCCCAGGTTAAGCCCGGGGCTTTCACATCTGACTTAATAAACCGCCTACGCACGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTAAAGTTAACGTCAAGGCTAACGGTTATTAACCGCTAACTTTTCTTCACAATTGAAAGTGCTTTACAACCCTCAGGCCTTCTTCACACACGCGGTATTGCTGGATCAGGGTTGCCCCCATTGTCCAATATTCCCCACTGCTGCCTCCCGTAGGAGTTCGGGCCGTGTCTCAGTCCCGATGTGGCTGATCATCCTCTCAGACCAGCTAAAGATCGTCGCCTTGGTAGGCTTTTACCCTACCAACAAGCTAATCTTACGCAGGCTCATCTGATAGCGTGAGGCTCGAAAGTCCCCCACTTTACTACGAATAGATTATGCGGTATTAATCCGAATTTCTTCGGGCTATCCCCCACTATCAGGCAGATTCCTACGCGTTACTCACCCGTCCGCCACTCGACGCCTACTAGCAAGCTAGTATCGTTTCCGTTCGACTTGCATGTGTTAAGCATACCGCCAGCGTTCAATCTGAGCCAT

  13. 2 Uncultured Alphaproteobacteria 13 10 1 1 Thiotrichales 2 plastid/ cyanobacteria 1 Uncultured Gammaproteobacteria

  14. Future Application • Two mixed cultures are undergoing continuing work • Uncultured Gammaproteobacteria (SAR 86?) • Plastid or cyanobacteria • Frozen stocks of cultures

  15. Conclusion • Ongoing focus of the Giovannoni lab is to cultivate new species as well as diverse members of already cultivated species • Filtering medium verses autoclaving it is a potentially viable means of cultivating rare or uncultured organisms

  16. Special thanks to… • Dr. Stephen Giovannoni For taking me into his lab • Dr. Kevin Ahern For his wonderful organization of this program • Paul Carini For all of his help day in and day out • The Howard Hughes Medical Institute For their continued support of this program

More Related