60 likes | 240 Views
DNA. The Secrets it tells us about Evolution!. Remember:. Gene – Chromosome – 1 molecule of DNA = 1 chromosome What are the building blocks of DNA? What are the building blocks of protein?. How do genes code for genetic traits?. Answer: 1 gene code for one protein! Examples:
E N D
DNA The Secrets it tells us about Evolution!
Remember: • Gene – • Chromosome – • 1 molecule of DNA = 1 chromosome • What are the building blocks of DNA? • What are the building blocks of protein?
How do genes code for genetic traits? • Answer: 1 gene code for one protein! • Examples: • Eye color • Hair color • Normal Blood clotting vs. hemophilia
We know how the code works! • CCCGATATTACGCTTAGGTACCGTC • Every 3 bases code for one amino acid!(See board)
DNA & Evolution • Chimpanzees and Humans share 98-99% of their DNA! • CCCGTCAGGCTAATACGAGCGGT • CCCGTCGGGCTAATACGAGCGGT
DNA & Evolution • Who can read the human genetic code? • The genetic code is UNIVERSAL! • Practical Implication:Genetic engineering: Bacteria are programmed with HUMAN insulin gene to produce………….?