270 likes | 277 Views
From Gene to Protein. Chapter 17 - Campbell. What do genes code for?. How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA. All the traits of the body. DNA. proteins. The “ Central Dogma ”. Flow of genetic information in a cell
E N D
From Gene to Protein Chapter 17 - Campbell
What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA All the traits of the body DNA proteins
The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait replication
RNA • Monomers = nucleotides • Phosphate • Ribosesugar • Nitrogen Bases • uracil instead of thymine • U bonds with A • C bonds with G • single stranded transcription DNA RNA
Types of RNA • Ribosomal RNA (rRNA) • Major component of ribosomes • Transfer RNA (tRNA) • Folded upon itself • Carries the amino acids to the mRNA • Messenger RNA (mRNA) • Sequence of nucleotides that determines the primary sequence of the polypeptide • Made in the nucleus from the DNA: transcription • snRNA (small-nuclear “snurps”) • Forms the “spliceosomes” which are used to cut out introns from pre-mRNA • siRNA (small-interfering) • targets specific mRNA and prohibits it from being expressed
Protein Synthesis: From gene to protein a a a a a ribosome aa aa aa aa a aa nucleus cytoplasm transcription translation DNA mRNA protein trait
Which gene is read on the DNA? • Promoter region • binding site before beginning of gene • Generally referred to as a TATA boxbecause it is a repeating sequence of T and A • binding site for RNA polymerase & transcription factors • Enhancer region • binding site far upstream of gene • Speeds up process
Transcription Factors • transcription factors bind to promoter region of DNA • proteins • can be activated by hormones (cell signaling) • turn on or off transcription • triggers the binding of RNA polymerase to DNA
Transcription: DNA to mRNA • Takes place in the nucleus • A section of DNA is unzipped • RNA polymerase lays down nucleotides 5’ to 3’ direction. • The mRNA then leaves the nucleus through the nuclear pores and enters the cytoplasm
Coding strand = this is the protein needed or “sense strand” Template strand = this is the “anti-sense strand”
Eukaryotic genes have untranscribed regions! intron = noncoding (inbetween) sequence exon = coding (expressed) sequence • mRNA must be modified before it leaves the nucleus • exons = the real gene • expressed / coding DNA • introns = non-coded section • in-between sequence • Spliceosomescut out introns with ribozyme intronscome out! eukaryotic DNA
Alternative splicing • Same piece of DNA can be read many different • Not all the exons may make it to the final product • Intron presence can determine which exons stay or go • Increases efficiency and flexibility of cell • snRNA’s have big role in alternative splicing Starting to gethard to define a gene!
Final mRNA processing… 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G • Need to protect mRNA on its trip from nucleus to cytoplasm(enzymes in cytoplasm attack mRNA) • protect the ends of the molecule • add 5 GTP cap • add poly-A tail • longer tail, mRNA lasts longer
The Transcriptional unit enhancer translation start translation stop exons 1000+b 20-30b RNA polymerase DNA introns promoter transcription start transcription stop pre-mRNA 5' 3' 5' 3' mature mRNA transcriptional unit (gene) 3' 5' TAC ACT TATA DNA GTP AAAAAAAA
Genetic Code • Genetic code is based on sets of 3 nucleotides …called CODONS! • Read from the mRNA • 64 different possible combinations exist • Only 20amino acids commonly exist in the human body • Some codons code for the same amino acids (degenerate or redundant) • Sequence of codons determines the sequence of the polypeptide • Code is “almost” universal…same for all organisms (evolutionary heritage)
The Code • You don’t need to memorize the codons (except for AUG) • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG
mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon MetArgValAsnAlaCysAla protein ? AUGCGUGUAAAUGCAUGCGCC mRNA
How is the code “translated?” Process of reading mRNA and creating a protein chain from the code.
Ribosomes: Site of Protein Synthesis • Facilitate coupling of tRNA anticodon to mRNA codon • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A
Ribosomes: 3 binding sites • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • EmptytRNAleaves ribosome from exit site Met C A U 5' G U A
Transfer RNA • Found in cytoplasm • Carries amino acids to ribosome • Contains an “anticodon” of nitrogen bases • Anticodons use complementary bond with codons • Less tRNA’s than codons, so one tRNA may bind with more than one codon. • Supports the degenerate code • “Wobble” hypothesis: anticodon with U in third position can bind to A or G
Translation: mRNA to Protein • In the cytoplasm ribosomes attach to the mRNA • Ribosome covers 3 codons at a time • Initiation- The tRNA carrying an amino acid comes into P-site and bonds by base pairing its anti-codon with the mRNA start codon (what is the start codon?) • Elongation – The second tRNA then comes into A-site and bonds to codon of mRNA • The two amino acids joined with peptide bond • Termination – ribosome continues reading mRNA until a STOP codon is reached (doesn’t code for anything) McGraw Hill Animations
Building a polypeptide 3 2 1 • Initiation • mRNA, ribosome subunits, initiator tRNA come together • Elongation • adding amino acids based on codons • Termination • STOP codon = Release factor Good Overview animation release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A
RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome
Prokaryote vs. Eukaryote Differences • Prokaryotes • DNA in cytoplasm • circular chromosome • naked DNA • no introns • No splicing • Promoter & terminator sequence • Smaller ribosomes • Eukaryotes • DNA in nucleus • linear chromosomes • DNA wound on histone proteins • introns and exons • TATA box promoter • Transcription factors present
Protein Synthesis in Prokaryotes • Transcription & translation are simultaneous in bacteria • Both occur incytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed